ID: 999468807

View in Genome Browser
Species Human (GRCh38)
Location 5:151832627-151832649
Sequence CAGAGTCCTGTATTTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9794
Summary {0: 1, 1: 32, 2: 357, 3: 6544, 4: 2860}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999468807_999468814 25 Left 999468807 5:151832627-151832649 CCTCCAAGAAATACAGGACTCTG 0: 1
1: 32
2: 357
3: 6544
4: 2860
Right 999468814 5:151832675-151832697 TGGTGTACCTGAAAGTGACGGGG 0: 1903
1: 5071
2: 2096
3: 983
4: 706
999468807_999468813 24 Left 999468807 5:151832627-151832649 CCTCCAAGAAATACAGGACTCTG 0: 1
1: 32
2: 357
3: 6544
4: 2860
Right 999468813 5:151832674-151832696 TTGGTGTACCTGAAAGTGACGGG 0: 2801
1: 3969
2: 1827
3: 865
4: 711
999468807_999468812 23 Left 999468807 5:151832627-151832649 CCTCCAAGAAATACAGGACTCTG 0: 1
1: 32
2: 357
3: 6544
4: 2860
Right 999468812 5:151832673-151832695 GTTGGTGTACCTGAAAGTGACGG 0: 22
1: 4124
2: 2162
3: 942
4: 673
999468807_999468809 5 Left 999468807 5:151832627-151832649 CCTCCAAGAAATACAGGACTCTG 0: 1
1: 32
2: 357
3: 6544
4: 2860
Right 999468809 5:151832655-151832677 AGACCAAACCTACGTTCAGTTGG 0: 1
1: 1
2: 4
3: 202
4: 1053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999468807 Original CRISPR CAGAGTCCTGTATTTCTTGG AGG (reversed) Intronic
Too many off-targets to display for this crispr