ID: 999474779

View in Genome Browser
Species Human (GRCh38)
Location 5:151888576-151888598
Sequence CCCAAACTGAAGTGCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999474776_999474779 -8 Left 999474776 5:151888561-151888583 CCTCATCAATTTCTTCCCAAACT 0: 1
1: 0
2: 1
3: 29
4: 346
Right 999474779 5:151888576-151888598 CCCAAACTGAAGTGCAGACAGGG 0: 1
1: 1
2: 2
3: 36
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999474779 Original CRISPR CCCAAACTGAAGTGCAGACA GGG Intronic
900502066 1:3011234-3011256 CCCAAACTGAGGTGTGGTCAGGG + Intergenic
901073652 1:6537947-6537969 CCCAGGCTGGAGTGCAGACGGGG - Intronic
901098150 1:6699252-6699274 CCCAGGCTGAAGTGCAGAGGTGG - Intronic
901578922 1:10224459-10224481 TCCAAACTGGAGTGCAGTGATGG + Intronic
902039546 1:13482932-13482954 ACCAAACTGAAGCACAGAGAGGG + Intronic
902087420 1:13874244-13874266 CCAAGACTGAGGTGCAGGCAGGG + Intergenic
903980403 1:27182598-27182620 CCCAGACAGAAGTGCAGATGAGG - Intergenic
904108849 1:28109050-28109072 CCCAAGCTGGAGTGCAGGCTCGG - Intergenic
904380452 1:30107197-30107219 CCCAAACTCAAGGCCAGGCAAGG - Intergenic
904709508 1:32418364-32418386 CCCAGACAGAAGTGCAGATAAGG - Intergenic
907543366 1:55237254-55237276 CCCAGACTGGAGTGCAGTCTGGG + Intergenic
908337123 1:63138043-63138065 CCCAAGTTGAAGTGCAGCGAAGG + Intergenic
909064806 1:70922548-70922570 CCCAGACAGAAGTGCAGATAAGG - Intronic
909687974 1:78372275-78372297 CCCAGACTGAAGTGCAGTGGCGG - Intronic
913451941 1:118998600-118998622 CCCAGACAGAGGTGCAGCCAAGG - Intergenic
915565290 1:156709560-156709582 AGCAAACTGAAGTGCAAGCAGGG + Intergenic
915665868 1:157444601-157444623 CCTAGACAGAAGTGCAGATAAGG + Intergenic
917216226 1:172680936-172680958 CCCAGGCAGTAGTGCAGACATGG - Intergenic
917236250 1:172894906-172894928 CACAAGCTGAAGAGCAGATATGG + Intergenic
917504460 1:175615323-175615345 CCCAGACTGAAGTCCAGGCTTGG - Intronic
918054841 1:181011827-181011849 CCCAAAGTGAAGTGCTCACACGG - Intronic
919389817 1:196968935-196968957 CCCAAGCTGAAGTGCAGTAGTGG - Intergenic
921151538 1:212406947-212406969 CCCAACCAGAAGTGCATAGATGG - Intronic
922226698 1:223651627-223651649 CCCAATATGAAGTGCGAACAAGG + Intronic
923138357 1:231139033-231139055 AGCAAACTGAGGTTCAGACATGG - Intergenic
924559391 1:245144916-245144938 ACTAAACTGATGTGCAGAGATGG - Intergenic
1062905980 10:1180047-1180069 TCAAAACTGCAGGGCAGACATGG + Exonic
1063332239 10:5172056-5172078 CCCAGACAGAAGCGCAGATAAGG + Intergenic
1064289781 10:14023078-14023100 TAGAAACTGAACTGCAGACAGGG - Intronic
1064310287 10:14206278-14206300 CCCCAACTTAAGTGCTGACTGGG - Intronic
1064535363 10:16352475-16352497 CCAAAACTTAAGTGAAGACCAGG + Intergenic
1064626801 10:17269674-17269696 CCCAGGCTGGAGTGCAGAGATGG - Intergenic
1067199425 10:44154432-44154454 CCCTGAATGAAGTGCACACAAGG + Intergenic
1067471297 10:46540608-46540630 CCCAAACTGAGGTTCAGCCTGGG + Intergenic
1070591681 10:77806266-77806288 ACCACACAGAAGTCCAGACAGGG + Intronic
1073126601 10:101154507-101154529 CCCAGGCTGAAGTGCAGTGATGG + Intergenic
1075197054 10:120368915-120368937 CTCAAACTTGAGTGCATACAAGG - Intergenic
1075215570 10:120529907-120529929 CCCAGGCTGGAGTGCAGAGATGG - Intronic
1077720533 11:4624104-4624126 CCCAGACAGAAGTGCAGATAAGG + Intergenic
1078814394 11:14804965-14804987 CCCAAACTGAAGCACAGAGAAGG + Intronic
1079033084 11:17000124-17000146 CCCAGACTGAAGTGCAGTGGTGG + Intronic
1080649532 11:34211149-34211171 CCCAAGCTGGAGTGCAGTAATGG + Intronic
1081154834 11:39677291-39677313 CCCAAACTGCACTGCAGAACTGG + Intergenic
1081990780 11:47336445-47336467 CCCAGACTGGAGTGCAGTCCTGG - Intronic
1082641172 11:55663367-55663389 CCCAAACTTAAGGACAGACAGGG + Intergenic
1083214861 11:61212123-61212145 CCCCAGGTGATGTGCAGACAAGG + Intronic
1083217745 11:61230952-61230974 CCCCAGGTGATGTGCAGACAAGG + Intronic
1083220741 11:61250702-61250724 CCCCAGGTGATGTGCAGACAAGG + Intronic
1083484130 11:62972509-62972531 CCCAAACTTAAGTGTCTACAAGG + Intronic
1085414011 11:76308385-76308407 CCCAATCTGAAGGGGAGACGTGG + Intergenic
1088104286 11:106188206-106188228 CCCAGACAGAAATGCAGATAAGG - Intergenic
1089443046 11:118531929-118531951 CCCAAACAGAAGTGCAGACAGGG - Intronic
1089897803 11:121949520-121949542 TGCAAACTGAGGGGCAGACATGG + Intergenic
1090291527 11:125550087-125550109 TCCAGACAGAAGTGCAGATAAGG + Intergenic
1091250722 11:134141693-134141715 CCCAAGCTGGGGTGCAGGCAGGG + Intronic
1091389286 12:116265-116287 CTCTAACTGTAGTGCAGACTTGG - Intronic
1092509666 12:9141831-9141853 CCCAGACAGAAGTTCAGATAAGG + Intergenic
1093920959 12:24858601-24858623 GCCAGACAGAAGTGCAGATAAGG - Intronic
1094693626 12:32794855-32794877 CCCACTCTGCAGTGCACACAAGG - Intronic
1095265090 12:40147032-40147054 CCCAGGCTGGAGTGCAGTCATGG - Intergenic
1095579694 12:43783358-43783380 CCCAGACTGAAGTGCAGTGGTGG + Intronic
1095676448 12:44924596-44924618 CCCAGACTGGAGTGCAGTGAGGG + Intergenic
1096256269 12:50064004-50064026 CCCAGACTGCCATGCAGACAGGG + Intronic
1096697642 12:53360451-53360473 CCCAGCCTGGAGTGCAGTCACGG - Intergenic
1097254377 12:57661633-57661655 CCCAGACAGAAATGCAGATAAGG - Intergenic
1097829717 12:64211147-64211169 CCAAAACTGAAGTACAGTTAAGG - Intronic
1097861126 12:64519660-64519682 CCCAACCTGAAGTTGGGACAGGG + Intergenic
1099385558 12:82008766-82008788 CCAAAACTGAGCTGCAGATATGG + Intergenic
1099940329 12:89180158-89180180 CCAAAACTGAAATGTTGACAGGG - Intergenic
1101032117 12:100671049-100671071 CTCAAGCTGAAGTGCAAGCAGGG + Intergenic
1101107686 12:101456173-101456195 CCCACACTGAAGTGCAGTAGTGG + Intergenic
1102366531 12:112341302-112341324 CTCAAACAGAAGTGCTGACCTGG - Intronic
1102531288 12:113548240-113548262 CCCAAACTGAAATGAACACAAGG + Intergenic
1103197655 12:119059115-119059137 CCCAAACAGAAGTGGTTACAGGG - Intronic
1103335042 12:120183036-120183058 CCCAACCTGGTGAGCAGACATGG + Intronic
1104196980 12:126549837-126549859 TTCAAACAGAAGTGCAGACCTGG + Intergenic
1104291171 12:127470100-127470122 CCAAAACTGAAGCACAGAAAAGG + Intergenic
1105807583 13:23964945-23964967 CCCAGGCTGAAGTGCAGAGATGG - Intergenic
1106079824 13:26490799-26490821 GACAAACAGAAGGGCAGACAAGG - Intergenic
1107017066 13:35716137-35716159 CACAGACTGAGGTGCAGAAAAGG - Intergenic
1107520352 13:41174557-41174579 CCCAAACTGGAATGCAGTGATGG + Intergenic
1107794197 13:44033070-44033092 CGGTAACTGAAGTGCAGACCAGG + Intergenic
1108508050 13:51130670-51130692 CCCAGTCAGAAGTGCAGATAAGG - Intergenic
1109293623 13:60504370-60504392 CCCAGACAGAAGTGCAGATAAGG + Intronic
1109609218 13:64741193-64741215 ACCAGACAGAAGTGCAGATAAGG - Intergenic
1114256495 14:21006746-21006768 CCTAGACAGAAGTGCAGATAAGG - Intergenic
1114827417 14:26098215-26098237 CCCAAACTGGAGTGGAAAGAGGG - Intergenic
1115447066 14:33502840-33502862 CTCAATCTGCAGTGCAGAGACGG - Intronic
1118390502 14:65291602-65291624 CCCAGGCTGGAGTGCAGTCATGG - Intergenic
1120182097 14:81354161-81354183 CCCAATCTGAAGTGACGACAGGG + Intronic
1121003903 14:90474349-90474371 ACCAGACAGAAGTGCAGATAAGG - Intergenic
1121610985 14:95279438-95279460 ACCAGACAGAAGTGCAGATAAGG - Intronic
1122218864 14:100222553-100222575 CACAAACCGAGGCGCAGACACGG + Intergenic
1122355641 14:101121459-101121481 GCCCAACTGAAGGGCAGCCAGGG - Intergenic
1122648911 14:103214391-103214413 CCCAAACTGATGTCCACACAGGG - Intergenic
1123721473 15:23065310-23065332 CCCAGGCTGGAGTGCAGTCAGGG + Intergenic
1124938518 15:34195646-34195668 CCCAGGCTGGAGTGCAGTCATGG - Intronic
1125909316 15:43421843-43421865 GGAAAACTGAGGTGCAGACAGGG - Exonic
1126988847 15:54346729-54346751 GCTAAACTGAAGTGCAGATGCGG - Intronic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1128253124 15:66177725-66177747 CCCAGACTGAAGTGCAGTGGCGG + Intronic
1128947760 15:71841684-71841706 CCCAGGCTGGAGTGCAGTCATGG + Intronic
1129100627 15:73259408-73259430 CCCAGTCTGGAGTGCAGTCATGG + Intronic
1129562314 15:76584183-76584205 CCCAAACATAAGTGAAAACAAGG - Intronic
1130092578 15:80833331-80833353 CCCAAGCTGAAATGCCTACAGGG - Intronic
1130096572 15:80860719-80860741 CCAAAACTGGGGTGCAGGCAAGG - Intronic
1130444726 15:83990159-83990181 TTCAAACTGAAGTCCAGAGAGGG + Intronic
1131552465 15:93369322-93369344 CCAAAACTGAGGTGTCGACATGG + Intergenic
1132212488 15:100034697-100034719 CCCAAACAGAACTGGAGAAAGGG + Intronic
1132923859 16:2416744-2416766 TCCAAAAGGAAGGGCAGACAAGG + Intergenic
1133382091 16:5339793-5339815 GGCAGACTGAAGTGCAGCCAAGG + Intergenic
1134100651 16:11449343-11449365 CCCAAACTGAAGAGGAGAAAAGG - Intronic
1135915338 16:26600505-26600527 CCTAAACTGAAGTTCAGATGTGG + Intergenic
1137865776 16:51894435-51894457 ACAAGACTGAAGTGCAGGCAGGG - Intergenic
1138161195 16:54756419-54756441 CACAGAAAGAAGTGCAGACATGG - Intergenic
1138782409 16:59805237-59805259 CCCAAACTGAAATACAGAAATGG + Intergenic
1139101947 16:63778234-63778256 CGCAAACTGAAATTCAGAAATGG + Intergenic
1139493921 16:67302324-67302346 CCCATACTGCAGTCCAGGCAGGG - Intronic
1140905820 16:79408217-79408239 CCCAAGCTGGAGTGCAGTGATGG + Intergenic
1142110116 16:88326845-88326867 AAGAAAATGAAGTGCAGACAAGG - Intergenic
1143664498 17:8348725-8348747 CACAAACTCAAATGCATACAGGG + Intergenic
1144783967 17:17821737-17821759 CCCAAAGAGAATGGCAGACAGGG + Intronic
1146362700 17:32190836-32190858 CCCAGACTGGAGTGCAGTGATGG + Intronic
1146737622 17:35252378-35252400 CCCAGGCTGGAGTGCAGTCATGG - Intronic
1147583502 17:41639498-41639520 CCCAATCTGAGGGGGAGACATGG - Intergenic
1147842446 17:43381566-43381588 CGAAAACTGAAGTGCAATCAGGG - Intergenic
1148602629 17:48906005-48906027 CCCAGACTGGAGTGCAGTGATGG - Intergenic
1148632806 17:49125502-49125524 CCTAGACAGAAGTGCAGATAAGG + Intergenic
1148785276 17:50143299-50143321 CCCAAACTGTACTCCAGACCGGG + Intronic
1148989903 17:51656872-51656894 CCCAAATTGAAGTGGAGAAGGGG - Intronic
1149224685 17:54455622-54455644 CCCAGACAGAAATGCAGATAAGG - Intergenic
1150526768 17:65931837-65931859 CCCAGCCTGAGGTGCAGGCAGGG + Intronic
1153575009 18:6511483-6511505 CACACACTGATGTACAGACATGG + Exonic
1155226179 18:23731546-23731568 CACAAACTGGTGTGCAGTCATGG + Intronic
1155247984 18:23928608-23928630 CACAAGCTGAAATGCAAACATGG - Exonic
1156000059 18:32374877-32374899 TATATACTGAAGTGCAGACATGG + Intronic
1156265447 18:35484024-35484046 ACCACACTGAAGTGGAGGCAAGG + Intronic
1156369450 18:36459537-36459559 CCCACACTGCAGGTCAGACAGGG - Intronic
1156580780 18:38372314-38372336 CGCAAACTGAAATGCCTACAGGG - Intergenic
1158601570 18:58860250-58860272 TCCAAACTGAGGTTCAGAAAAGG + Intergenic
1158864212 18:61621711-61621733 CCTAGACAGAAGTGCAGATAAGG - Intergenic
1159342415 18:67153032-67153054 CCCAAAGTGCAGGGAAGACAAGG + Intergenic
1160743619 19:699537-699559 CCCAAACTGAGGCCCAGAGAGGG + Intergenic
1162206647 19:9061151-9061173 CCCAAGCTGGAGTGCAGTGATGG + Intergenic
1162711673 19:12599545-12599567 CCTAGACAGAAGTGCAGATAAGG - Intronic
1163490224 19:17613364-17613386 CCCAGACTGAAGTGCAGTGGCGG - Intronic
1165255359 19:34574542-34574564 CCCAGGCTGGAGTGCAGACTGGG - Intergenic
1165521201 19:36315462-36315484 CCCACACTGAAGTCCAGTGAGGG + Intergenic
1165622866 19:37263128-37263150 CCCACACTGAAGTCCAGTGAGGG - Intergenic
1166014225 19:39968091-39968113 ATGAAACTGAGGTGCAGACAGGG - Intergenic
1167927382 19:52832550-52832572 CCCAAGCTGGAGTGCAGTGATGG - Intronic
1168408585 19:56123913-56123935 CCCATACTGAAGTGCAGTGGTGG - Intergenic
1202646408 1_KI270706v1_random:145946-145968 CCCAATCTGGAGTGCAGTGATGG - Intergenic
925439833 2:3875910-3875932 CCCAAACTGAGGTGTCGGCAGGG + Intergenic
926746760 2:16164996-16165018 CCCAGCCTGAAATACAGACATGG - Intergenic
930305811 2:49673292-49673314 CCCAAACTGGAGTGCAGTGATGG + Intergenic
930506625 2:52289755-52289777 CCTAGACAGAAGTGCAGATAAGG + Intergenic
932932988 2:76064379-76064401 CCCAGGCTGGAGTGCAGTCACGG + Intergenic
932966051 2:76475680-76475702 CCCAAACAGAAATGAAGATAAGG - Intergenic
933315710 2:80712284-80712306 TCAATACTGAAGTGCTGACATGG - Intergenic
935197951 2:100831337-100831359 CACAAACTGAAGTGCTGACGTGG - Intronic
935202385 2:100869547-100869569 CCCAAACTGACCTTCACACAAGG - Intronic
936180879 2:110266299-110266321 CCCAAACTGAAGAACAAATAGGG + Intergenic
938245991 2:129778469-129778491 CCCACACAGATGGGCAGACAAGG - Intergenic
939137235 2:138312213-138312235 GCCAAACTGAAGTGCATAGAAGG + Intergenic
939415175 2:141887036-141887058 CCCAACCTGGAGTGCAGTGATGG + Intronic
941228417 2:162878359-162878381 ACTAAACTGAAGGGCAGATAGGG - Intergenic
943662247 2:190571498-190571520 CCCAGACTGAAGTGCAGTGGCGG - Intergenic
943969330 2:194383440-194383462 CACAGACAGAAGTGCAGATAAGG + Intergenic
944322658 2:198366300-198366322 CCCAAGCTGGAGTGCAGTGATGG + Intronic
946098459 2:217296980-217297002 TCCAAACTGAGGTACAGAGAGGG + Intronic
947640305 2:231703994-231704016 TGCAAACTGAAGTGCCCACAGGG + Intergenic
1168821935 20:779758-779780 CCTAGACAGAAGTGCAGATAAGG - Intergenic
1170839076 20:19909157-19909179 CAAAAACTGAAGAGCAGACTGGG - Intronic
1170933766 20:20792365-20792387 CCCAAACTGTGGTGCAGACATGG - Intergenic
1172457299 20:35087489-35087511 GCCAAACTGAAGGGCATCCAGGG + Intronic
1174837292 20:53869507-53869529 CCCAGGCTGAAGTGCAGTCGTGG - Intergenic
1174888717 20:54365789-54365811 CCCAAACTGAAGTGGAAATATGG - Intergenic
1175479843 20:59302909-59302931 TCAAAAATGAAGTGCAGACGAGG + Intronic
1175839390 20:62017195-62017217 CGCAGACTTAAGTGCACACATGG + Intronic
1176150654 20:63589096-63589118 CCCAAGCTGAAGGGCCCACATGG + Exonic
1176605465 21:8826811-8826833 CCCAATCTGGAGTGCAGTGATGG + Intergenic
1177294700 21:19159831-19159853 CCAAAACAGAAATTCAGACATGG - Intergenic
1177355345 21:19999363-19999385 CCAAAACCGAAGTACCGACATGG + Intergenic
1178313674 21:31551690-31551712 CCTAGACTGTAGTGCAGTCACGG - Intronic
1180347760 22:11718416-11718438 CCCAATCTGGAGTGCAGTGATGG + Intergenic
1181002036 22:19992352-19992374 CCGAGACTGAGGTGCAGACTGGG + Intronic
1181377625 22:22472623-22472645 CCCAGGCAGGAGTGCAGACATGG + Intergenic
1181832399 22:25571462-25571484 CCCATATTGAATTTCAGACACGG + Intronic
1183312756 22:37120019-37120041 CCCAAACTCAGATGCTGACAGGG - Intergenic
1183576228 22:38691312-38691334 CCCAGGCTGGAGTGCAGTCATGG - Intronic
1183999164 22:41659725-41659747 CCCAGACTGAAGTGCAGTGGTGG + Intronic
1185082962 22:48719737-48719759 CGCAAAATGGATTGCAGACAGGG - Intronic
949553851 3:5135329-5135351 CCCAGACTGGAGTGCAGTCTTGG + Intronic
949892118 3:8740975-8740997 CCCAAACTGACATGCATAAAGGG + Intronic
949962766 3:9327611-9327633 CCCAGACAGAAATGCAGATAAGG + Intronic
950605649 3:14077395-14077417 CCCAGACAGAAATGCAGATAAGG + Intronic
951193596 3:19799555-19799577 CCTAGACTGAAGTGCAGTGAAGG + Intergenic
952294936 3:32053078-32053100 ACCAGACAGAAGTGCAGATAAGG - Intronic
953416291 3:42720422-42720444 AGCAAACAGAAGTGCAGATAAGG - Intronic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
954122389 3:48507070-48507092 CCCAGGCTGGAGTGCAGTCACGG + Intergenic
954545527 3:51431475-51431497 CCCAGACTGGAGTGCAGAGGCGG - Intronic
956766912 3:72491810-72491832 CCCAAGCTGGAGTGCAGTGACGG - Intergenic
956897202 3:73674729-73674751 CCCAAACTCAAATGCCCACAGGG - Intergenic
956915611 3:73868011-73868033 CCCAAAGGGAAGTGAGGACATGG + Intergenic
956964705 3:74445303-74445325 CCCAAACTGGAGTGCAGTGGTGG + Intronic
957141354 3:76362319-76362341 CCCAGGCTGGAGTGCAGAAATGG - Intronic
957153898 3:76521738-76521760 TCCAAAAAGAAGTGCAGACAAGG - Intronic
957724688 3:84048578-84048600 CCCAGACAGAAATGCAGATAAGG - Intergenic
957737609 3:84223498-84223520 ACCAGACAGAAGTGCAGATAAGG + Intergenic
958968382 3:100584611-100584633 ATCAGACAGAAGTGCAGACAAGG + Intergenic
959571850 3:107893264-107893286 CCCTAACTGAATTACACACATGG - Intergenic
960514819 3:118591688-118591710 CCCAGACAGAAGTGCAGATAAGG - Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961344846 3:126257344-126257366 CAAAGACTGAAGTGCAGACCAGG + Intergenic
961354682 3:126329440-126329462 CCCAGGCTGGAGTGCAGAGATGG - Intergenic
961546633 3:127638880-127638902 TACAAACTGAAGTGAAGACAGGG - Intronic
962600019 3:136984633-136984655 CCCAAGCTGAAGAGCAGAGGAGG + Intronic
964961690 3:162435795-162435817 CCCAGACAGAAGTGCAGATAAGG + Intergenic
965089565 3:164145167-164145189 ACCAGACAGAAGTGCAGATAAGG - Intergenic
965588253 3:170338775-170338797 ACCACACAGAAGTGCAGATAAGG + Intergenic
965869198 3:173246429-173246451 ATCAGACAGAAGTGCAGACAAGG + Intergenic
967154554 3:186680628-186680650 CCCAAGTTGAAGTGCGGTCATGG - Intergenic
970709425 4:18844294-18844316 ACCAAACTGAAGTGCTGAGTGGG - Intergenic
971944237 4:33253587-33253609 CCTAGACAGAAGTGCAGATAAGG + Intergenic
972819043 4:42678022-42678044 CCCAGACAGAAATGCAGATAAGG - Intergenic
973372634 4:49264093-49264115 CCCAATCTGGAGTGCAGTGATGG - Intergenic
974991098 4:69091983-69092005 CCCAGGCTGAAGTGCAATCATGG + Intronic
975271441 4:72438826-72438848 CTCAAAATGTAGTGCAGAGAGGG - Intronic
976091009 4:81457385-81457407 CCCAGGCTGAAGTGCATAAATGG - Intronic
977949292 4:102951609-102951631 CCCAAACAGCAGTCTAGACATGG + Intronic
979985309 4:127306597-127306619 CCCAAGCTGAGGTGCAGAGATGG - Intergenic
980779728 4:137480256-137480278 CCCAAACGAAAGACCAGACATGG + Intergenic
981681825 4:147408171-147408193 CCCAGGCTGGAGTGCAGGCATGG - Intergenic
983012078 4:162559911-162559933 CCTAGACAGAAGTGCAGATAAGG + Intergenic
983088842 4:163480145-163480167 TCCAAACTGAAGTTCAGAAGGGG - Intergenic
984441458 4:179775752-179775774 CCCAGACAGAAGTACAGATAAGG - Intergenic
987184959 5:15407877-15407899 CCCAAGCTGGAGTGCAGTGATGG + Intergenic
988816684 5:34841001-34841023 CCCAGACTGGAGTGCAGTGATGG - Intronic
993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG + Intergenic
993980790 5:94541229-94541251 CCCAGACAGAAGTGCAGATAAGG - Intronic
994697349 5:103089133-103089155 GCCATACTGAAGTACTGACAGGG + Intronic
994704288 5:103181527-103181549 CCCAGGCTGCAGTGCAGTCAGGG - Intronic
995906974 5:117136323-117136345 CCCAAACTGCTTTGCACACATGG + Intergenic
997541154 5:134663780-134663802 CCAAATCTGTAGTGGAGACAAGG - Intronic
998260463 5:140627276-140627298 ACCAGACAGAAGTGCAGATAAGG + Intergenic
998983398 5:147728922-147728944 ACCAGACAGAAGTGCAGATAAGG - Intronic
999474779 5:151888576-151888598 CCCAAACTGAAGTGCAGACAGGG + Intronic
999718991 5:154384838-154384860 GTAAAACTGGAGTGCAGACAGGG - Intronic
1000061159 5:157656536-157656558 CACAGACAGAAGTGCAGATAAGG - Intronic
1000066534 5:157697459-157697481 CCTCAACAGAAGTGAAGACAAGG - Intergenic
1002173265 5:177386840-177386862 CCGACACTGCAGTCCAGACAGGG + Intronic
1004432448 6:15557048-15557070 ACCAGACAGAAGTGCAGACAAGG - Intronic
1004515917 6:16322180-16322202 CCCAGGCTGAAGTGCAGTGATGG - Intronic
1005181408 6:23111471-23111493 CCCAGACAGAAGTGCAGATAAGG + Intergenic
1005393066 6:25353321-25353343 ATAAAACTGAGGTGCAGACAGGG + Intronic
1006194892 6:32233803-32233825 CCCAGGCTGAAGTGCAATCATGG + Intergenic
1007163270 6:39810160-39810182 CCCAAACTGCAGTGGAGTCCGGG + Intronic
1007450824 6:41939678-41939700 CCCAAGCTGAGGGACAGACAGGG - Intronic
1008002030 6:46370696-46370718 CACACACTGAAATGCAGGCAGGG - Intronic
1008584360 6:52935399-52935421 CCAAAACTGGAGTGAAGAGATGG + Intergenic
1008935194 6:56984176-56984198 CCCAGTCTGAAGTGCAGTGATGG - Intronic
1009001473 6:57721699-57721721 CCCAAACTCAAGTGCCGCCTTGG + Intergenic
1010720005 6:79272234-79272256 CACATACTGAAGAGCAGAGAGGG - Intergenic
1011156687 6:84341144-84341166 GCAAACCTGGAGTGCAGACACGG - Intergenic
1012259576 6:97072055-97072077 CCCAAGCCGAAGTGTAGACTAGG - Intronic
1012379716 6:98605625-98605647 CAGATCCTGAAGTGCAGACACGG + Intergenic
1013250929 6:108332656-108332678 CCCAGGCTGGAGTGCAGTCATGG + Intronic
1013409403 6:109870793-109870815 CCAACCCTGAAGTGGAGACATGG + Intergenic
1017348596 6:153413910-153413932 CCCAGACAGAAGTGCAGATAAGG + Intergenic
1017465960 6:154694055-154694077 CCCAGACTGGAGTGCAGTAATGG + Intergenic
1018357443 6:163033280-163033302 CCCAGACAGAAGTGCAGATAAGG + Intronic
1019038798 6:169085468-169085490 TCCTAAGTCAAGTGCAGACAGGG - Intergenic
1022579990 7:31542215-31542237 CCTAGACAGAAGTGCAGATAAGG + Intronic
1022620874 7:31983570-31983592 CCCAGGCTGCAGTGCAAACATGG - Intronic
1022746966 7:33182350-33182372 ACCAGACAGAAGTGCAGATAAGG + Intronic
1022960659 7:35423315-35423337 CCAAAACTGAGGTGCTGGCAGGG + Intergenic
1023587670 7:41748106-41748128 ACCAGACAGAAGTGCAGATAAGG + Intergenic
1023719918 7:43082297-43082319 CCCAAATCAAATTGCAGACATGG + Intergenic
1023742520 7:43293436-43293458 TCCCATCTGCAGTGCAGACAAGG + Intronic
1025107170 7:56181055-56181077 CCCAGACTGAAGTGCAGTCAAGG - Intergenic
1025797193 7:64749607-64749629 CCTAGACAGAAGTGCAGATAAGG + Intergenic
1026764619 7:73152720-73152742 CCCAAACAGAAATGCATTCAGGG - Intergenic
1026877477 7:73887758-73887780 CCCACACTGAAGTCCAGCCCTGG - Intergenic
1027041089 7:74962488-74962510 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG + Intergenic
1027804544 7:82800414-82800436 AGGAAACTGAAGTGCACACATGG - Intronic
1027960942 7:84944175-84944197 CCCAGACAGAAATGCAGATAAGG - Intergenic
1028389000 7:90293779-90293801 CCCAGACAGAAGTACAGATAAGG + Intronic
1028512763 7:91643278-91643300 CCAAAACTGATTTGCAGGCAAGG + Intergenic
1029954312 7:104621551-104621573 TCCAAACAGAGGTGCTGACATGG + Intronic
1030996343 7:116363084-116363106 CCCATTCTGAAGCGCAGACTTGG - Intronic
1031305248 7:120117751-120117773 CCCAGACAGAAATGCAGATAAGG - Intergenic
1031742733 7:125455127-125455149 CCCAGACAGAAATGCAGATAAGG + Intergenic
1032220746 7:129992233-129992255 ACCAAACGAAAGTGCAAACATGG + Intergenic
1033062717 7:138123535-138123557 CCCAAACTAACCTGCAGTCAGGG + Intergenic
1033562060 7:142541707-142541729 CAGAATCTGAAGTGGAGACAGGG - Intergenic
1037443587 8:18942400-18942422 GCACAACTTAAGTGCAGACAGGG + Intronic
1038169372 8:25114945-25114967 CAGAAACTGAAGTCCAGAGAAGG - Intergenic
1039183865 8:34895154-34895176 CCCAGACAGAAGTGCAGATAAGG - Intergenic
1040594633 8:48825437-48825459 CCCACTCTGAAGTGAAGAAAAGG - Intergenic
1041198369 8:55424667-55424689 CCCAAAGTGAATTACACACAAGG - Intronic
1042448193 8:68913975-68913997 CCCAACCCCAAGTGCAGATAAGG + Intergenic
1043100402 8:76038014-76038036 CCCAAGCTGGAGTGCAGAGGAGG - Intergenic
1044533502 8:93334418-93334440 CCTAATCTGAAGTGCAGATGGGG + Intergenic
1045329865 8:101146422-101146444 CCCAGACTGTAGGGCAGAGAAGG - Intergenic
1046260510 8:111761018-111761040 TCCAAACTGAAATGCAGAGAGGG + Intergenic
1046385541 8:113504222-113504244 CCTAGACAGAAGTGCAGACAAGG + Intergenic
1046922933 8:119752938-119752960 CCCAAAATGAGGAGCAGGCAGGG + Intronic
1048727309 8:137400948-137400970 GCCAACGTGAAGTGCAGGCAAGG - Intergenic
1049661021 8:143819811-143819833 CCCACACTGAAAAGGAGACATGG - Intronic
1050923240 9:11232444-11232466 CCTAGACAGAAGTGCAGATAAGG + Intergenic
1052138031 9:24939952-24939974 CCCAAACCCAAGTCCTGACATGG + Intergenic
1052569694 9:30203727-30203749 CCCAGACTGAAGTGCAGTGGTGG + Intergenic
1052794539 9:32911153-32911175 CCCAGGCTGGAGTGCACACATGG - Intergenic
1052936347 9:34096333-34096355 CCCAAGTTGGAGTGCAGTCATGG - Intronic
1053082526 9:35189325-35189347 CCCAGACAGAAGTGCAGATAAGG + Intronic
1055055535 9:72020731-72020753 AAGAAACTGAAGTTCAGACAAGG - Intergenic
1055889299 9:81105741-81105763 CCCACACTGGAATGCAAACAGGG + Intergenic
1055970742 9:81910176-81910198 CCCAGACAGAAATGCAGATAAGG + Intergenic
1057759281 9:97859726-97859748 CCCAGACTGACTTGGAGACAGGG - Intergenic
1058822951 9:108749150-108749172 CCCAAATTTCAGTGTAGACAGGG + Intergenic
1059314040 9:113409315-113409337 CCCAAGCTGGAGTGCAGTGATGG - Intronic
1060823384 9:126673943-126673965 CCCAAACAGACGGACAGACAAGG - Intronic
1061110285 9:128564530-128564552 CCCAGGCTGGAGTGCAGTCACGG - Intronic
1203552868 Un_KI270743v1:178903-178925 CCCAATCTGGAGTGCAGTGATGG + Intergenic
1185934742 X:4243311-4243333 CCCAAATTGAAATTCAGAGATGG + Intergenic
1186597109 X:10994182-10994204 CCCAAGCTGAAGTGCAGTGGCGG - Intergenic
1187530285 X:20090319-20090341 CCCAGGCTGGAGTGCAGACAGGG - Intronic
1189073018 X:37885286-37885308 ACCAGACAGAAGTGCAGATAAGG + Intronic
1189675665 X:43458170-43458192 CACAAACTGAAGTTTAGACCTGG - Intergenic
1189741479 X:44121419-44121441 CCTAGACTGGAGTGCAGATATGG - Intergenic
1193330965 X:80235508-80235530 ACCAGACAGAAGTGCAGATAAGG + Intergenic
1193363884 X:80607881-80607903 CCCAGACAAAAGTGCAGATATGG - Intergenic
1193392982 X:80950860-80950882 TCCAAGCTGAAGTGCAGGGAGGG - Intergenic
1193705469 X:84815934-84815956 CTCAGACAGAAGTGCAGATAAGG + Intergenic
1193791187 X:85816748-85816770 CCCAAACAGAAGTGCAGGTAAGG - Intergenic
1194187896 X:90795939-90795961 ACCAGACTGAAGTGCAGATATGG - Intergenic
1195219815 X:102736007-102736029 ACCAGACAGAAGTGCAGATAAGG + Intronic
1196074354 X:111558641-111558663 CCTAGACAGAAGTGCAGATAAGG + Intergenic
1196559909 X:117133437-117133459 CCAAAACAGAAGTACAGCCAAGG + Intergenic
1197481205 X:126988746-126988768 CCCAGACAGAAGTGCAGATAAGG - Intergenic
1198665370 X:139016425-139016447 CCCAATCTGAAGTAAACACAGGG + Intronic
1198855591 X:141012197-141012219 CCCAGACGGAAGTGCGGAGAAGG - Intergenic
1198876543 X:141233999-141234021 CCCAGACGGAAGTGCGGAGAAGG + Intergenic
1198907104 X:141575171-141575193 CCCAGACGGAAGTGCGGAGAAGG + Intergenic
1200534486 Y:4377886-4377908 ACCAGACTGAAGTGCAGATATGG - Intergenic
1201638946 Y:16158455-16158477 CCCAGTCTGGAGTGCAGAGACGG + Intergenic
1201723162 Y:17125066-17125088 CCCAGACTGGAGTGCAGTGATGG - Intergenic