ID: 999475059

View in Genome Browser
Species Human (GRCh38)
Location 5:151890836-151890858
Sequence GCATTGTTAACATAACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999475059_999475069 20 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475069 5:151890879-151890901 ACAAGGTGCAGGGGGAGTGAAGG 0: 1
1: 0
2: 3
3: 40
4: 429
999475059_999475063 3 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475063 5:151890862-151890884 AAGCTATGGCCTCAGGAACAAGG No data
999475059_999475065 10 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475065 5:151890869-151890891 GGCCTCAGGAACAAGGTGCAGGG 0: 1
1: 0
2: 0
3: 33
4: 475
999475059_999475064 9 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475064 5:151890868-151890890 TGGCCTCAGGAACAAGGTGCAGG No data
999475059_999475068 12 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475068 5:151890871-151890893 CCTCAGGAACAAGGTGCAGGGGG 0: 1
1: 0
2: 4
3: 22
4: 237
999475059_999475066 11 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475066 5:151890870-151890892 GCCTCAGGAACAAGGTGCAGGGG 0: 1
1: 0
2: 3
3: 26
4: 256
999475059_999475070 30 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475070 5:151890889-151890911 GGGGGAGTGAAGGAGCCTCAAGG No data
999475059_999475062 -4 Left 999475059 5:151890836-151890858 CCTGGGGGTTATGTTAACAATGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 999475062 5:151890855-151890877 ATGCTGGAAGCTATGGCCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999475059 Original CRISPR GCATTGTTAACATAACCCCC AGG (reversed) Intronic
907463175 1:54618036-54618058 GCATTTTTAACACACTCCCCAGG + Intronic
908049687 1:60215508-60215530 TCATTGTAAACATAAGTCCCTGG + Intergenic
909366623 1:74831304-74831326 GCATAGTTTACATTACCCCATGG - Intergenic
922414555 1:225408754-225408776 GCAATATTAACATAGCCCCAGGG - Intronic
1067053926 10:43040563-43040585 CCATCGTTACCATCACCCCCTGG - Intergenic
1067976794 10:51035488-51035510 GCTTTATTAACATAACACCTGGG + Intronic
1073523745 10:104159882-104159904 GCATTTTTAACAAATCCCCCAGG + Intronic
1075234482 10:120714302-120714324 GCTTTGTTAAAATCACCCTCTGG - Intergenic
1075575384 10:123573633-123573655 GTATTTTTAAAATAATCCCCAGG - Intergenic
1089417659 11:118305979-118306001 GCATTTTTAACAAGATCCCCAGG - Intronic
1090097068 11:123752724-123752746 GGATTGTCACCAAAACCCCCAGG - Intergenic
1090489686 11:127147761-127147783 ACATTTTTAACAAAATCCCCAGG - Intergenic
1096971609 12:55670862-55670884 GCATTTTTAACAAGACTCCCAGG - Intergenic
1097780452 12:63697279-63697301 TAATTGTTAACATTCCCCCCTGG + Intergenic
1098261139 12:68672483-68672505 CCATTGTTAAAATAACACCTTGG + Intergenic
1102068810 12:110000378-110000400 GCATTTTTAACAAACTCCCCAGG + Intronic
1102557188 12:113734875-113734897 GCATTTTTAACAACATCCCCAGG - Intergenic
1106505770 13:30369347-30369369 GCTTTGTAAACAGATCCCCCTGG - Intergenic
1110846226 13:80193219-80193241 GCAATGTTAACATATATCCCTGG + Intergenic
1126787139 15:52186539-52186561 GCAATGGCAACATAACCCCTCGG - Intronic
1127453085 15:59135341-59135363 CCCTTGTTATCATAAGCCCCTGG - Exonic
1135493635 16:22932333-22932355 GCATTTTTAACAAGATCCCCGGG + Intergenic
1140196716 16:72861325-72861347 GCAATGTGAACCCAACCCCCAGG + Intronic
1153595555 18:6721552-6721574 GCATCTCTAACATAACCTCCTGG + Intergenic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156259956 18:35437076-35437098 CCAGTGTTAACATAACACCTAGG - Intergenic
1156543994 18:37945634-37945656 GCACTGTAAACATCACCACCAGG + Intergenic
1159166410 18:64706698-64706720 TCATTGTTAACATAAACCAGTGG + Intergenic
926691192 2:15735062-15735084 GCATTCTTAATATAGCACCCTGG + Intronic
930027026 2:47035146-47035168 GGAATGTTAACAGAAGCCCCGGG - Intronic
930516117 2:52409920-52409942 ACAGTGTAAACATAGCCCCCAGG - Intergenic
931761515 2:65421417-65421439 GCATTCTTAACAAACTCCCCAGG - Intronic
933699393 2:85243862-85243884 ACATTGTGAACAGCACCCCCTGG + Intronic
938658243 2:133458045-133458067 GAATTTTTAACATAGCCTCCAGG - Intronic
939134743 2:138279900-138279922 GCATTTTTAACAAGACCCCCAGG + Intergenic
941110946 2:161418164-161418186 ACATTGTTTACATATGCCCCTGG - Intronic
942381265 2:175393666-175393688 ACATTCTTAACAAACCCCCCAGG - Intergenic
942640707 2:178058165-178058187 GCATTATTAGCTAAACCCCCTGG + Intronic
946658809 2:221977529-221977551 GCTTAGTTAACAAAACTCCCTGG + Intergenic
947803204 2:232945175-232945197 ACATTGATAACATAACCCACAGG + Intronic
1169251593 20:4064986-4065008 GCATTTTTAACAAGAGCCCCAGG - Intergenic
1170471765 20:16674942-16674964 GCATTGTTAACAATATCCGCTGG - Intergenic
1172264259 20:33597396-33597418 CCTGTCTTAACATAACCCCCAGG - Intronic
1173405595 20:42761696-42761718 GCATTTTTAACAAGATCCCCAGG - Intronic
1173861266 20:46285179-46285201 GCATTGTTAGCAGAACTGCCTGG + Intronic
1177032573 21:16000090-16000112 CCATTGGTAACTTAACCTCCTGG + Intergenic
1182918251 22:34055315-34055337 GCATTTTTAACAAACCTCCCTGG - Intergenic
950863517 3:16171185-16171207 GCATTGTTGATCTAACCTCCAGG - Intergenic
955326907 3:58015655-58015677 GCATTTTTAACAAAGTCCCCAGG - Intronic
955636012 3:61030277-61030299 GCATTTTTAACAAGAACCCCAGG + Intronic
955760902 3:62281166-62281188 GAATTATTAACATAATCCACAGG + Intronic
957992344 3:87642749-87642771 GCATTTTTAACAATAGCCCCAGG + Intergenic
967136310 3:186515675-186515697 GCATTTTTCACATATACCCCAGG - Intergenic
973154997 4:46940067-46940089 GCATTTTTAAAATAACTCACAGG - Intronic
973982629 4:56318844-56318866 TCATTGTTAACTAAAACCCCTGG + Intronic
975915026 4:79314492-79314514 GCATTTTTAACATAGCACCCAGG + Intronic
979557877 4:122071294-122071316 TCATTATTAACATAGCACCCTGG - Intergenic
982914675 4:161191816-161191838 ACGTTGTGAACATAACTCCCAGG + Intergenic
984455134 4:179957038-179957060 GCATTGTTGAAATAACACACTGG + Intergenic
985921977 5:2984472-2984494 GCATTTTTAACAGAATCCCCAGG - Intergenic
988878913 5:35478740-35478762 GCATTTTTAACATGGACCCCAGG - Intergenic
991589895 5:68239685-68239707 GCAGTGTGAACATTAACCCCCGG - Intronic
992119583 5:73577262-73577284 GCATTGTTAACATTAAACGCAGG + Intronic
992177174 5:74161356-74161378 GCATTTTTAACATACCTCTCGGG - Intergenic
992970699 5:82054322-82054344 GCATTTAAAACATAATCCCCAGG - Intronic
999475059 5:151890836-151890858 GCATTGTTAACATAACCCCCAGG - Intronic
1001918806 5:175584273-175584295 GCATTTTAACCATCACCCCCTGG - Intergenic
1004093136 6:12525845-12525867 GGATTGGTACCATGACCCCCAGG - Intergenic
1005642859 6:27813408-27813430 ACATTTGTAACATAACACCCAGG + Intergenic
1006871471 6:37255963-37255985 GCACTGTTAACTACACCCCCTGG + Intronic
1014678990 6:124404919-124404941 GCAATGTTAACATAAAACCCAGG + Intronic
1014727689 6:124992044-124992066 GCAATGTTAACAAGATCCCCAGG - Intronic
1017829018 6:158108050-158108072 GCATTGTCAACATCACCTCAAGG - Intergenic
1018908497 6:168088717-168088739 GCTTTGTAGACAGAACCCCCAGG + Intergenic
1021325879 7:19267038-19267060 GCATTATTAACATGTCTCCCAGG - Intergenic
1021414412 7:20365667-20365689 GCATTAATAACATAACCTCAGGG + Intronic
1022939029 7:35213354-35213376 TAATTGTTAACATTCCCCCCTGG + Intronic
1026254630 7:68699816-68699838 GCATTTTTAACAAGACCCCCAGG - Intergenic
1026348130 7:69492662-69492684 GCACTTTTAACAAATCCCCCAGG + Intergenic
1039087376 8:33793327-33793349 GCAGTGATAACATTACCCCTTGG - Intergenic
1039335208 8:36581626-36581648 GCATTTTTAACATGATCCTCAGG + Intergenic
1042940191 8:74099563-74099585 GCAGTGTTAGCATAATCCCAGGG - Intergenic
1043441003 8:80277055-80277077 GCATTTTAAACAAGACCCCCAGG + Intergenic
1044537731 8:93376420-93376442 GCATTTTTAACAAACTCCCCAGG - Intergenic
1047162396 8:122395293-122395315 GCAATGTTAACATTGCCCTCTGG - Intergenic
1049130872 8:140839304-140839326 GCAGTGTAAACAAAGCCCCCTGG + Intronic
1050784694 9:9386730-9386752 TCATTGTTAAATTAACCCTCTGG + Intronic
1051769283 9:20558677-20558699 GCATTTTTAAACAAACCCCCAGG + Intronic
1054873331 9:70069411-70069433 GTAATGTTAACATAAGCCTCAGG + Intronic
1055567482 9:77583746-77583768 GCATTTTTAACAAGATCCCCAGG - Intronic
1056083375 9:83120474-83120496 GCATTGTTAAGCTTACTCCCAGG - Intergenic
1059876178 9:118637613-118637635 ACATTGCTATCATAACCTCCTGG - Intergenic
1186061982 X:5718903-5718925 GATTTGTTGACATAACCACCAGG - Intergenic
1196247059 X:113412806-113412828 GCTTAGTTCACTTAACCCCCTGG + Intergenic
1197082589 X:122437968-122437990 GCTTTTTTAACCTCACCCCCCGG + Intergenic
1198520330 X:137446006-137446028 GCAGTGTTAAAATATACCCCTGG + Intergenic
1202276534 Y:23126547-23126569 GCATTTTTAACATGTGCCCCAGG - Intergenic
1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG + Intergenic
1202429527 Y:24760269-24760291 GCATTTTTAACATGTGCCCCAGG - Intergenic
1202441264 Y:24909821-24909843 GCATTTTTAACATGTGCCCCAGG + Intergenic