ID: 999477342

View in Genome Browser
Species Human (GRCh38)
Location 5:151912664-151912686
Sequence CAGAGCCAATAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 416}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999477342 Original CRISPR CAGAGCCAATAGAAGGAGGA TGG Intronic
900503516 1:3017989-3018011 CAGAGCCAGAAGAAGCAGGAAGG - Intergenic
901470596 1:9453861-9453883 CACAGCCCAGAGATGGAGGAGGG + Intergenic
901747765 1:11385836-11385858 CAGAGCCAAAAGCTGGAGGAAGG - Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
905401641 1:37707954-37707976 CAGACCCCACAGAAGGATGAGGG - Intronic
905871061 1:41404848-41404870 CAGAGCCTAGTGAGGGAGGAGGG + Intergenic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906749347 1:48245201-48245223 AACTGCCAAGAGAAGGAGGAAGG + Intronic
907566749 1:55442677-55442699 CACAGCCACTGGAAGGAGGTAGG - Intergenic
907582224 1:55582639-55582661 GAGGGGCAATGGAAGGAGGAAGG + Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910624417 1:89291511-89291533 CACAGCCAATACAAGGAGATGGG + Intergenic
912520109 1:110239356-110239378 CTCAGCCAAGAGAAGGAGGTGGG - Intronic
912941088 1:114045512-114045534 AAGAACCAATAGAAAGAGTAGGG + Intergenic
913238455 1:116805996-116806018 TAGAGCCCAAAGAAGGATGAAGG + Intergenic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
917775522 1:178330063-178330085 CAGAGCCATTAGTAGGGGTAGGG + Intronic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
918326223 1:183413248-183413270 GGGAGCCAATACCAGGAGGATGG + Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919624820 1:199901120-199901142 CAAAGACAATAAAAGGTGGAAGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920062107 1:203234015-203234037 CAGAGGCAAGAGAATTAGGAAGG - Intronic
920086196 1:203419218-203419240 CATAGCCAATATGTGGAGGATGG - Intergenic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920945032 1:210520643-210520665 CAGAGACAATGGGAGGAGGATGG - Intronic
921752669 1:218815243-218815265 CTGAGCCAGTAGAAGGAACATGG + Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922193900 1:223343059-223343081 AATAGCCAATAAAAAGAGGAAGG + Intronic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
923400742 1:233613993-233614015 GAGAGCCAATCGCAGGAAGACGG + Exonic
924030870 1:239884358-239884380 CAGAGCCACTAGAAACTGGAAGG + Intronic
924476884 1:244390301-244390323 TAGAACCAAAAGATGGAGGAAGG - Intergenic
1063384689 10:5608724-5608746 CAGAGACACTGCAAGGAGGAAGG + Intergenic
1064931903 10:20637826-20637848 CAGAGCCAATAGGAGGTATATGG + Intergenic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066289174 10:33998404-33998426 TAGAGCCAAAAGGTGGAGGAAGG + Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1068489645 10:57706967-57706989 CAGAGCCAACAGACAGAGAAGGG + Intergenic
1069543331 10:69311974-69311996 CAGAGGCAATTTAATGAGGATGG + Intronic
1070415882 10:76188831-76188853 CAAACCCAAGAGGAGGAGGATGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1072005613 10:91243911-91243933 TATAGACAATAGAAGGAAGATGG + Intronic
1072522016 10:96237382-96237404 CAGAGCAAATATAGGGTGGAGGG - Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075318068 10:121467958-121467980 CAGAGCCTTCAGAAGGAGCATGG + Intergenic
1075462889 10:122630603-122630625 CAGTGCCAAGAGAAAGAGAATGG - Intronic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076642823 10:131930400-131930422 AAAAGCCAAGAGAAGGAAGATGG - Intronic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077364410 11:2155749-2155771 CAGAAACAATAGTGGGAGGAAGG + Intronic
1077534685 11:3117972-3117994 AAGAGAAAATAGTAGGAGGAAGG - Intronic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078730889 11:13973023-13973045 CACAGCCAAGAGATTGAGGATGG - Intronic
1078778793 11:14417804-14417826 CAGAGCCAATACAAAGAAGAGGG + Intergenic
1078897437 11:15609428-15609450 CAGAGCCAATAGGATGTGAAAGG + Intergenic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079248361 11:18769766-18769788 TAGAGCAAATAGAAAGAGCAAGG + Intronic
1079964008 11:26958553-26958575 AAGAGCCAATAAAAAGGGGAGGG + Intergenic
1080232922 11:30037868-30037890 AAGAGACAAGAGAAGGAGGGAGG + Intergenic
1080835856 11:35940363-35940385 CAGAGACACTAGAAGGACCAAGG - Intergenic
1080923995 11:36737276-36737298 CAGAGACAAAGGGAGGAGGAGGG - Intergenic
1082821496 11:57547308-57547330 CAGAGCCACTGGAAGGTGGGAGG + Intronic
1083526809 11:63374911-63374933 CAAAGCTGATAGAAGGAAGATGG - Intronic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1084996729 11:72987124-72987146 GAGAGACCATAGAAGGAAGAGGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086753078 11:90523858-90523880 CAAAGAGAATAGAAGGATGATGG - Intergenic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087837644 11:102890897-102890919 AAGAGGCAAGAAAAGGAGGAAGG - Intergenic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1088228886 11:107653202-107653224 TACAGCCAATAGAAGGAGGCAGG - Intronic
1088314845 11:108497690-108497712 CAGAGCCGTAGGAAGGAGGAGGG - Intronic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1088675502 11:112188613-112188635 CAGAGATGATGGAAGGAGGAAGG - Intronic
1088693667 11:112348592-112348614 CAGAACCAATAGGATGTGGATGG - Intergenic
1088704703 11:112451519-112451541 CAAAGGCAATGGATGGAGGATGG - Intergenic
1090096828 11:123750569-123750591 CAGATCCAAGAAAAGGAGGAAGG - Intergenic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090534839 11:127629396-127629418 CAGAGCCAAAAGAAAGAACACGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090848493 11:130549919-130549941 CAAAGCCAAGAGAAGAAAGAGGG - Intergenic
1090970301 11:131636653-131636675 CAGAGCCCACGGAAGGAGAATGG + Intronic
1091643529 12:2255511-2255533 CAGTGCCAATCAAAGGAGGTCGG + Intronic
1092006192 12:5072441-5072463 CAGAGCCACTAGAAGCAAGCTGG - Intergenic
1092008012 12:5085833-5085855 CAGAGCCTAAAGAAGGTGCAGGG - Intergenic
1092291255 12:7160553-7160575 AAGAGGCCAGAGAAGGAGGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093650086 12:21633386-21633408 CAGAGCCAAGAGCTGGAAGAAGG - Intergenic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096682725 12:53267661-53267683 TACAACCAATAGAAGGAGTAAGG + Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100959424 12:99945997-99946019 CAGAGCCAATATCTGGAGGGAGG + Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101213175 12:102555005-102555027 CTGAGACAATGGAAGGAGAAAGG - Intergenic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1104014515 12:124953039-124953061 CACAGCGAATGGCAGGAGGATGG + Intronic
1104481439 12:129111298-129111320 CAGAGCCTCTGGAAGGAGTATGG + Intronic
1104876537 12:132038838-132038860 CAGGGCCACATGAAGGAGGAGGG - Intronic
1105251132 13:18699087-18699109 CAGAGCCCATGGAAGCAGCAGGG - Intergenic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105468631 13:20671380-20671402 AAGTGCCACGAGAAGGAGGATGG + Intronic
1106586948 13:31065791-31065813 CAGAGCCAATAGAAGTCTCAGGG - Intergenic
1108267429 13:48726262-48726284 CAGAACCAAAAGACAGAGGAAGG + Intergenic
1109110220 13:58308208-58308230 CAGAACCAATAGAAGAAAGAAGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1112364689 13:98746876-98746898 CAGAGGCTTAAGAAGGAGGAAGG - Intronic
1112617870 13:101023899-101023921 GATAGTCACTAGAAGGAGGATGG - Intergenic
1113347098 13:109489661-109489683 AAGAGCCAATAGACAGAGAAAGG - Intergenic
1115927790 14:38456325-38456347 CAGAGCCAAAGGAAGAAGCAAGG - Intergenic
1116150912 14:41141205-41141227 CAGAGCCTTCAGAAGGAGTATGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119535564 14:75400168-75400190 TAGAGGCAAAAGAAGGGGGAAGG - Intergenic
1121556546 14:94842110-94842132 TAGAACCAATAGGAGGTGGATGG - Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1124036913 15:26062231-26062253 CAGAGACAATAGATGAAGGGAGG - Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125291083 15:38147566-38147588 GAGAGCCAATAGATAGAGGCTGG - Intergenic
1125476487 15:40051167-40051189 CACAGCCAACAGAGGAAGGAGGG + Intergenic
1126158995 15:45591944-45591966 CACAGCTAATAAAAGGAGGTTGG - Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128087702 15:64897347-64897369 CACATCCAATAGAAGGGGCAAGG + Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1131195555 15:90352215-90352237 AAAAGCCAATAGCAAGAGGATGG + Intergenic
1131430076 15:92380253-92380275 CAGACCCACCAGAAGGAGGCTGG - Intergenic
1131475119 15:92731813-92731835 CAGGGCTACTAGAAGGGGGAGGG + Intronic
1133548549 16:6831707-6831729 CAAACCCAAGAGATGGAGGAAGG - Intronic
1133997872 16:10761945-10761967 GAGGGGCAATGGAAGGAGGAGGG + Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135147379 16:19974513-19974535 CAGAACCAATAAGAGTAGGAGGG - Intergenic
1135818331 16:25656390-25656412 CAAAGCCAAAAGATGAAGGATGG + Intergenic
1136271985 16:29153805-29153827 CAGAGCCTCTGGAAGGAGTATGG - Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139478886 16:67217334-67217356 CAGAGCCAGGACTAGGAGGAAGG - Intronic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1141636610 16:85317330-85317352 GAGAGCCAAGAGGAGAAGGAGGG - Intergenic
1142075574 16:88115723-88115745 CAGAGCCCCCAGAAGGAGTACGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143986029 17:10915208-10915230 CATAGTCAATAGAAGGAGAAAGG + Intergenic
1145029608 17:19494904-19494926 CAGAGGCTCTAGAAGGAGCAGGG + Intergenic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1146447864 17:32947138-32947160 GAGAACCAATAGGAGGAGGCTGG + Intergenic
1147382053 17:40062059-40062081 CAGAGTCAATCTAAGGAAGACGG - Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148755452 17:49970708-49970730 CAAAGACAATTGCAGGAGGAGGG - Intronic
1148985098 17:51613675-51613697 CAGAACCAATAGGATAAGGAGGG - Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149381461 17:56098183-56098205 TAGAGCCTAGAGAAGGAGGATGG + Intergenic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150964115 17:69948031-69948053 TAAAGCCAATAAAAGGGGGATGG + Intergenic
1151166786 17:72210749-72210771 CAGAGCCAATAGGAAGAGAGAGG + Intergenic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152302965 17:79506216-79506238 CAGAGCCAGAAAAGGGAGGAGGG + Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152805069 17:82351822-82351844 CAGAGCCGATTGGAGGAGGAGGG + Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153769977 18:8407709-8407731 CAGAGCCCATGGGAGGTGGAAGG + Intergenic
1154297569 18:13163700-13163722 CAGATCCAGAAGAAGGAGAAAGG + Intergenic
1156690168 18:39697799-39697821 TAGAACCAAGAGAAGGAGAAGGG - Intergenic
1156957872 18:42990830-42990852 CAGACCCAATAGGAGGGGGTTGG + Intronic
1157602949 18:48905407-48905429 CCCACCCAATAGAAGGTGGAGGG + Intergenic
1157750702 18:50175583-50175605 CATAGACAGTAAAAGGAGGAAGG - Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158565309 18:58549992-58550014 CAGAGCTACTGGGAGGAGGAAGG - Intronic
1158726184 18:59974979-59975001 CAGAGTCAGTAGAAAGAGAAAGG + Intergenic
1159020010 18:63135685-63135707 CAGGGACAATTGACGGAGGAAGG - Intronic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1165477568 19:36040008-36040030 CAGCGCCACTGGAAGCAGGAGGG + Exonic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
929094563 2:38251186-38251208 CAGAGCCTAGAGTTGGAGGATGG - Intergenic
930733412 2:54750582-54750604 CACAGCCAAGAGATGGAGAAAGG - Intronic
932684041 2:73852652-73852674 CAGAAGCCATAGGAGGAGGAAGG + Intronic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
935535216 2:104285669-104285691 CACTGCCAAGAGAAGGAGAAAGG - Intergenic
935947933 2:108302945-108302967 AAGAGCCAAGAGATGGAGCACGG + Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
939553902 2:143650592-143650614 CAGAGCCAAATGAAGGAGACAGG + Intronic
940378034 2:152979560-152979582 GAGAGACACTAGAAGCAGGAAGG - Intergenic
940882122 2:158957190-158957212 CAGAGCCTCTGGAGGGAGGATGG + Intergenic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
943772497 2:191733481-191733503 CAGAACCAGTGGAAGGAGGGTGG + Intergenic
944486873 2:200216145-200216167 AAGAGCCCATGGAAGGAGGTTGG - Intergenic
945569204 2:211443117-211443139 CAAAGGCAATAGAAAGAGTAAGG - Intronic
945956397 2:216090232-216090254 AAGAGCCAGTAGAAGGAAGTTGG + Intronic
946625225 2:221604428-221604450 AAGAGACAATATAAGGTGGAAGG - Intergenic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1171777963 20:29388312-29388334 CAGAGCCAGTAGAATGTGGAGGG - Intergenic
1171819726 20:29823708-29823730 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1173318785 20:41968988-41969010 CACAGCCACCAGAAAGAGGAGGG + Intergenic
1174670915 20:52306904-52306926 CAGAGCTATTGGAAGGATGAGGG + Intergenic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1175002922 20:55649360-55649382 CAGAGCCAGTGGAACGAGGGAGG + Intergenic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1176152001 20:63596191-63596213 CTGTGCCTTTAGAAGGAGGAAGG - Intronic
1177148639 21:17432717-17432739 GAGATCCCATAGAAGAAGGAAGG + Intergenic
1178185598 21:30216167-30216189 CTCAGCCAATAAAAGGTGGATGG + Intergenic
1178966838 21:37128167-37128189 CAGAGCCAATGTAATAAGGAGGG - Intronic
1179100872 21:38354816-38354838 CTGAGCCAAAAGATGGAGAAAGG - Intergenic
1179138650 21:38702723-38702745 CAGACCCATTAGAAGCAAGAGGG - Intergenic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1180323728 22:11348399-11348421 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181724012 22:24798586-24798608 CACAGCCAATACAGGGAGGTGGG + Intergenic
1181724200 22:24800117-24800139 CACAGCCAATACAGGGAGGTGGG - Intergenic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183384077 22:37504949-37504971 CTGAGACAATAGCAGAAGGAAGG + Intronic
1183514925 22:38259629-38259651 CAGAGCCTCCAGAAGGAGTATGG + Intronic
1184020026 22:41814587-41814609 CAGATACGATAGATGGAGGAAGG + Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184873640 22:47258412-47258434 GGGAGCCCATAGATGGAGGAGGG + Intergenic
950401749 3:12774333-12774355 CAGAACCAAAAGGTGGAGGAAGG - Intergenic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952207561 3:31195453-31195475 CAAAGTCAATAGAAGGTTGATGG + Intergenic
954279867 3:49569701-49569723 TAGAGCCAATAGAATGAGCCAGG - Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956738701 3:72258641-72258663 CAGACCCAAAGGAAGGAGGAGGG + Intergenic
957087209 3:75692247-75692269 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
958534051 3:95373201-95373223 CAGAGCTAATAGAAACAGCACGG - Intergenic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
959321898 3:104887170-104887192 CAGAGCCCATAGCAGGAGGAGGG + Intergenic
959739952 3:109706357-109706379 TAGAGCCAATAGAAAGGAGAGGG - Intergenic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
962171516 3:133106129-133106151 CAGAGCCTATAAGAGGAGGCTGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
963393885 3:144706644-144706666 CAGAGCCAATGAAAGGAGAAGGG + Intergenic
963404691 3:144847486-144847508 CAGAGACAATGGAAGAAGGAAGG + Intergenic
963762058 3:149294284-149294306 CTGGGCCTATAGAAGGAGAAAGG - Intergenic
965698173 3:171431052-171431074 AAGAGCCAAAACAAGCAGGACGG - Intronic
967121486 3:186386312-186386334 TAGAGCCAGTAGACAGAGGATGG + Intergenic
967264492 3:187678324-187678346 CAAAGCCAAGAGAAGGAAAAGGG + Intergenic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967727028 3:192871671-192871693 CAGAGCCAAGAGAATGAAGAGGG + Intronic
968505721 4:970452-970474 CAGAGCCCTTAGAGGGAGGGTGG + Intronic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
970228639 4:13885858-13885880 CTGAGGCAATAGAATGTGGAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971193073 4:24446179-24446201 CAAAGCCAAGATAAGAAGGACGG + Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
973723822 4:53752122-53752144 CATAGCTAATACATGGAGGAAGG - Intronic
974620782 4:64350804-64350826 CAGAACCAAAAGAATGTGGAGGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976695273 4:87912633-87912655 CAGATCCGATGGAAGGAGGAAGG - Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
978001411 4:103558969-103558991 CAGAGCAAAGTGTAGGAGGACGG + Intergenic
979416891 4:120452429-120452451 GAGAGGGAAAAGAAGGAGGAAGG + Intergenic
979708998 4:123755496-123755518 GAGAGCCAATCTAAGGAGTATGG + Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
980554981 4:134391954-134391976 CAGAGCCTTTGGAAGGAGGATGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981938607 4:150258546-150258568 AAGAGCTAATAAAAGGAAGAAGG + Intergenic
982194708 4:152899300-152899322 CATAGGGAATAGAAAGAGGAGGG - Intronic
982962532 4:161858663-161858685 CAGAGCTAATATAATGAGAATGG - Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983944743 4:173572916-173572938 CAGAGCTACTGGAAGGAGGATGG + Intergenic
984646273 4:182223948-182223970 CAGAGGCAATGGAAGAAAGATGG + Intronic
985283501 4:188310454-188310476 GAGAGGCCAAAGAAGGAGGATGG - Intergenic
986491966 5:8302360-8302382 TAGAGCCAAGAGAAGATGGATGG - Intergenic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988570707 5:32362401-32362423 CAGAGACAAAGGAAGGAAGAGGG + Intronic
988611960 5:32735245-32735267 CAGAGCCAGATGGAGGAGGAGGG - Intronic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
992433684 5:76734404-76734426 CACAGCCAATCCCAGGAGGATGG - Exonic
993060881 5:83037589-83037611 CAGAGTCATTAGAAGGAAGCAGG + Intergenic
995609614 5:113895293-113895315 CAGAGGCAGTAGCAGAAGGAAGG + Intergenic
996574351 5:124965576-124965598 CAGAGCCAATAAAAGGCCCATGG + Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998198346 5:140096426-140096448 CAGAGCTAAAAGGAGCAGGAGGG + Intergenic
998288264 5:140884593-140884615 CAGAACCCAGACAAGGAGGAAGG - Exonic
998950801 5:147391443-147391465 CAGAGGCAATATGAGGAGGTTGG + Exonic
999034811 5:148335627-148335649 CAGAGCCAAGAGTAGGACTATGG - Exonic
999154876 5:149450916-149450938 CAGACCCAGCAGAAGGAAGAGGG - Intergenic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999623105 5:153491725-153491747 GAGAGCCAACAGGAGGAGAAAGG - Intronic
999717323 5:154371748-154371770 CAGAGCCAATGCAAGGAGAATGG - Intronic
999823522 5:155252222-155252244 CAGAGGCCATGGATGGAGGAAGG + Intergenic
1000347201 5:160324104-160324126 CAGAACCAATAGAAGACGAATGG - Intronic
1001024018 5:168207821-168207843 GAGAGACAAAGGAAGGAGGAAGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001769640 5:174283647-174283669 AAGAGCTAATAAAAGGAGGGAGG + Intergenic
1002422219 5:179154615-179154637 AGGAACCAATTGAAGGAGGAAGG - Intronic
1004449493 6:15731734-15731756 CAGAGCGATTATAAAGAGGATGG + Intergenic
1005136258 6:22571519-22571541 AAGAGACAATAGATGGAGAAAGG - Exonic
1006743750 6:36326869-36326891 CAGAGCCCAGAGCAGGGGGAGGG + Intronic
1006888250 6:37400181-37400203 CAGAACCAACAGGAGAAGGAAGG - Intergenic
1007288716 6:40768004-40768026 CATAGCCACAAGATGGAGGAGGG + Intergenic
1007855714 6:44854295-44854317 AAGAGTCCATAGAAGGATGATGG - Intronic
1008045739 6:46849588-46849610 CAGAGCCAAGTGAAGGATGCCGG - Intergenic
1008651012 6:53562796-53562818 AAGAGACAATAGTAGGAGGAAGG - Intronic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011632911 6:89344873-89344895 GAGAGCCAATAGAAGACAGAGGG - Intronic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013054093 6:106566282-106566304 CAGAGCCAAGACAAGGAGTGAGG - Intronic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1013459985 6:110365524-110365546 CAGAGCAAATAGGGGAAGGAAGG - Intergenic
1013535364 6:111058710-111058732 CAGAGTCAAACAAAGGAGGAAGG + Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015198672 6:130553522-130553544 TAAAACCAATAGAGGGAGGAGGG - Intergenic
1015385641 6:132619962-132619984 CAGAGAGAATACAAGGTGGAGGG + Intronic
1015428932 6:133107088-133107110 CAGAGCCAGTGGAGGGAGCAGGG - Intergenic
1015455471 6:133422768-133422790 CAAAGCCAATAGCAGGCAGAGGG - Intronic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017587035 6:155937809-155937831 AAGAGCCAAAAGAAGGAGTGGGG + Intergenic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1017949127 6:159120892-159120914 CTGAAGCAATAGCAGGAGGAAGG - Intergenic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019949837 7:4362416-4362438 CAGAGACCATAGAAGGAACAGGG - Intergenic
1020410225 7:7884039-7884061 AAGATCCAAAAGAAGGATGAGGG - Intronic
1020918338 7:14227582-14227604 CACAGAAAATAGAAGAAGGAAGG + Intronic
1023883490 7:44334905-44334927 CAAAGCCAGTGGATGGAGGAGGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025770489 7:64500782-64500804 CAAAGCCAAAAACAGGAGGAAGG - Intergenic
1025802682 7:64801909-64801931 CAGAGCCAAAAGAGGAAGGCAGG - Intronic
1026217801 7:68365040-68365062 GAGAGCCAAGAGATGGAGGGAGG + Intergenic
1027772854 7:82429378-82429400 TAGAGGCAACAGAAGGAAGAAGG + Intronic
1028232489 7:88322267-88322289 GAGAGGCAATAGAGGAAGGAAGG + Intergenic
1028655980 7:93207519-93207541 GAAAGGCAAAAGAAGGAGGAAGG + Intronic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1030644532 7:112045128-112045150 AATAGCCAGTAGAATGAGGAAGG - Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031959196 7:127973651-127973673 CAGAACCAAAAGAATGAGGTTGG - Intronic
1032072383 7:128816247-128816269 CAGTGCCAAAAGAGGGATGAGGG - Intronic
1032431041 7:131861785-131861807 CAGGGCTACTAGAAGCAGGAAGG - Intergenic
1033061174 7:138109599-138109621 CAGCTCCACTAGAAGGGGGAAGG + Intronic
1033134394 7:138772956-138772978 GAGAGCCAAGGGGAGGAGGAGGG + Intronic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1035530351 8:346041-346063 CAGAGCCAATGGGATGTGGAGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1037312580 8:17572450-17572472 CAGAGACAGTTGAAAGAGGAGGG + Intergenic
1037477304 8:19270291-19270313 CCCAGCCACTAGAAGGTGGAGGG + Intergenic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1039472844 8:37824900-37824922 CAGAAGCAATGAAAGGAGGAGGG - Intronic
1040444360 8:47478422-47478444 CAGAGACAGAAGAAGCAGGAAGG + Intronic
1041496474 8:58491072-58491094 GAGAGGCCAAAGAAGGAGGATGG - Exonic
1043480581 8:80648277-80648299 GAGAGCCATTAGCAGGAAGAAGG - Intronic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045315472 8:101040257-101040279 CAGAGCCACCAGAAGCTGGAAGG - Intergenic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1046449719 8:114372561-114372583 CAGAACCAATAGGAGATGGACGG + Intergenic
1046763514 8:118045721-118045743 CAGCTGCAATAGAAAGAGGAAGG - Intronic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048477275 8:134754926-134754948 CAGAGCCAAGAGATGGGAGATGG + Intergenic
1049298365 8:141855781-141855803 AGGAGCCAACAGCAGGAGGAGGG + Intergenic
1049832060 8:144707250-144707272 GAGAGCCAGTGGATGGAGGATGG + Intergenic
1051310333 9:15764120-15764142 CAGAGTCAATAGTGGGAGAAAGG + Intronic
1051348537 9:16175455-16175477 CAGAGCCAAGAGAAGGGTAAGGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052271958 9:26636434-26636456 CAGGGCCAAAAGAATGTGGAAGG - Intergenic
1053651834 9:40177120-40177142 CAGAGCCAAGTGAAGGATGCCGG + Intergenic
1053750661 9:41251267-41251289 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054256172 9:62815610-62815632 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054335132 9:63800004-63800026 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1055291447 9:74786121-74786143 CAGATCTAAAAGAAGGAAGAAGG + Exonic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056522096 9:87411198-87411220 CGGAGCAAAAAGCAGGAGGACGG - Intergenic
1056581778 9:87892497-87892519 CAAAAGCAATTGAAGGAGGAAGG - Intergenic
1057004968 9:91549040-91549062 TGGAGCCAAGAGCAGGAGGAAGG - Intergenic
1057030089 9:91768886-91768908 CACAGCCAATAGGAGGATAAAGG + Intronic
1057187084 9:93062995-93063017 CAGTGCCAAGAGTAGGAGGCTGG - Intronic
1057407835 9:94789730-94789752 CCAAGCCAGTAGAAGGAGGTAGG - Intronic
1057408386 9:94794219-94794241 GAGAGCCAAAAGAGGGAGAAGGG + Intronic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059575795 9:115486945-115486967 CAGAGGCAAAAGAAGTGGGATGG - Intergenic
1060190721 9:121590710-121590732 CAGAGCCTATTGATGGAGGTGGG + Intronic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1061169021 9:128941348-128941370 CAAAACCACTGGAAGGAGGAGGG + Intronic
1062009982 9:134261715-134261737 GAGAGACAATAGAAACAGGAGGG + Intergenic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1203371400 Un_KI270442v1:308973-308995 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1185758889 X:2674084-2674106 CAGAGCCCTGAGAAGGAGAAGGG - Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1187497586 X:19808690-19808712 CAGACCCCATAGAAGTAGGTAGG - Intronic
1189751961 X:44231455-44231477 GAGAGCGAAAGGAAGGAGGAGGG - Intronic
1191159000 X:57307172-57307194 CAGAGAGAATAGAAAGATGAAGG - Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194044843 X:88989787-88989809 AAGAGCAAATAGTGGGAGGAAGG - Intergenic
1195510348 X:105709171-105709193 CAGAGCCAACAGAAGCAGCCAGG + Intronic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1196735757 X:118979627-118979649 CAGGGACATTAGAAAGAGGAAGG + Intronic
1196963848 X:121033700-121033722 TAGAGCCTTTAGAAGGAGCATGG + Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1198083845 X:133264723-133264745 CAAGGCCAATAGGAGGAGAAGGG - Intergenic
1198567691 X:137921647-137921669 GAGAACCAAGAAAAGGAGGAGGG + Intergenic
1199549473 X:149042893-149042915 CAGATCCAATGGAAGTAGGGAGG - Intergenic
1199680459 X:150220905-150220927 CAGAGCCACCAGAAGCTGGAGGG - Intergenic
1200301788 X:154983840-154983862 CAGAGACAAATGAGGGAGGAAGG - Intronic
1201066944 Y:10106110-10106132 CAGAGCCAGTGGAATGTGGAGGG + Intergenic