ID: 999478455

View in Genome Browser
Species Human (GRCh38)
Location 5:151923788-151923810
Sequence AGAGTTTGGAAAGGTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 403}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999478455 Original CRISPR AGAGTTTGGAAAGGTGGGTT GGG Intronic
901118742 1:6872456-6872478 AGAGTGGGGAAAGGTGAATTTGG - Intronic
902148327 1:14421787-14421809 AGGGTTTTGAAAGGTGAGCTTGG - Intergenic
902267824 1:15280908-15280930 GGATTTTGGCCAGGTGGGTTAGG - Intronic
902544045 1:17175259-17175281 AGAATATGGACAGGTGGGGTGGG - Intergenic
903033071 1:20477149-20477171 AGAGGTTAGAGAGGGGGGTTGGG - Intergenic
903792971 1:25906778-25906800 AAAGTTTGGAAAGGTAGGGAAGG - Intronic
903921118 1:26801775-26801797 AGAGTTTGGGTAGGTTGGCTGGG + Intergenic
904944733 1:34190901-34190923 ACAGTTTGGCAATTTGGGTTGGG + Intronic
905684733 1:39900737-39900759 ACAGTTTGGAAAAGTGGCGTGGG - Intronic
905801906 1:40849679-40849701 GGAGTCAGGAAAGTTGGGTTCGG - Intergenic
905927762 1:41764096-41764118 TGAGATGGGAAGGGTGGGTTGGG + Intronic
907248631 1:53123412-53123434 AGAGCCTGGGAAGGTGGGTGAGG - Intronic
907554180 1:55330675-55330697 AGAGCTTGGAAAGCAGGGCTGGG + Intergenic
908783886 1:67716125-67716147 AGAGGTGGGAAATGTGGTTTCGG + Intronic
909944787 1:81651342-81651364 AGAGTTTCTAAAAGTAGGTTGGG + Intronic
909972551 1:82007909-82007931 ATAGTTTGGTCAGGTGGGATGGG - Intergenic
910108099 1:83653215-83653237 AGAGTTGAGAAGGGTGGATTTGG - Intergenic
911018240 1:93358225-93358247 AGAGCATAGAAAGGTGGGTCTGG - Intronic
911460503 1:98183053-98183075 AGACTGTGGAATGGTGGATTAGG - Intergenic
911661728 1:100509020-100509042 TGAGTTTGGAAAGCTGGTTGGGG - Intronic
915443716 1:155962536-155962558 TGAGTTGGGGAGGGTGGGTTTGG + Intronic
917434275 1:175003087-175003109 AGAGTGTGGACAAGAGGGTTGGG + Intronic
918123076 1:181556841-181556863 AGAGGTGTGAAATGTGGGTTTGG + Intronic
918475358 1:184918455-184918477 AGAAGCTGGACAGGTGGGTTGGG - Intronic
918822261 1:189270157-189270179 AGAATTTGGAAAGAGAGGTTTGG + Intergenic
919481780 1:198098986-198099008 TGAGTTTGGAGAGGTAGGATGGG + Intergenic
919569602 1:199230434-199230456 AGAGCTTGGAAGTGTGGTTTTGG + Intergenic
920107632 1:203565547-203565569 AGACATTGGAAACATGGGTTTGG - Intergenic
920385856 1:205569639-205569661 AGAGTTTGCAGAGGTGGGGAGGG + Intronic
920590520 1:207214279-207214301 AGAGTTAGGAATGGTGGGCCAGG - Intergenic
920804634 1:209220916-209220938 AAAGGCTGGAAAGTTGGGTTTGG - Intergenic
922919527 1:229290338-229290360 AGAGGTAGGGGAGGTGGGTTGGG - Intronic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
924955158 1:248919234-248919256 AGAGCTTGGAAAGGGTAGTTAGG - Intronic
1063661660 10:8038321-8038343 AGAGTTTGGAAAGGTTACATTGG - Intergenic
1064676296 10:17763651-17763673 TGAGCTTGGAAAGATGGGTGTGG + Intronic
1065315194 10:24457214-24457236 AGAGTTGGGGAGGTTGGGTTGGG + Intronic
1065482671 10:26211551-26211573 GCAGTTTGGAAAGGTGAGTTTGG - Intronic
1065504552 10:26416121-26416143 TGAGGTTGGAGAGGTGGGGTTGG + Intergenic
1068922255 10:62497024-62497046 TGTGTTTGGAAAGGTAGGTTTGG + Intronic
1068986189 10:63109663-63109685 AGAGTGGGGAATGGTGGGTGTGG + Intergenic
1069021557 10:63494018-63494040 AAAGTTTGGAAAGTTGGGCCTGG + Intergenic
1069927273 10:71859517-71859539 AGAGATTGCAAAGCTGGGCTAGG - Intergenic
1071391044 10:85175674-85175696 TTAGTTTAGAAAGATGGGTTTGG - Intergenic
1072627216 10:97120337-97120359 AGACATTGGAAAGGAGGGTGGGG - Intronic
1072793727 10:98338150-98338172 GGAGGTTTGAAAGGTGCGTTGGG - Intergenic
1072850821 10:98889822-98889844 AGAGTTTGGAACGGAGGATGGGG + Intronic
1074204209 10:111267931-111267953 TGAGTATAGAAGGGTGGGTTTGG + Intergenic
1075084459 10:119405193-119405215 AGGGGGTGGACAGGTGGGTTGGG + Intronic
1075835419 10:125448735-125448757 AGAGTCCGGAAGGCTGGGTTTGG - Intergenic
1076127828 10:127989853-127989875 AGAGATTAGAAAGCTGGATTTGG - Intronic
1076994003 11:289513-289535 TGCGTTTGGAAAGCAGGGTTAGG + Intronic
1077888596 11:6403478-6403500 AGAATTTTGGAAGGTGGGTAAGG - Exonic
1078893300 11:15576866-15576888 AGAGTTGGCAAAGGAGGGTGAGG - Intergenic
1079051167 11:17161030-17161052 AGAGTTGGCAGAGGTGAGTTTGG + Intronic
1079329500 11:19521963-19521985 AGAGTTTAGGCAGATGGGTTTGG + Intronic
1079435750 11:20447326-20447348 AGAATTTGGGACTGTGGGTTGGG + Intronic
1081445641 11:43129303-43129325 ATAATTTGGAAAGGCAGGTTGGG - Intergenic
1083096139 11:60253560-60253582 AGAGTTTGGAAGGAGGGCTTGGG + Intergenic
1083106331 11:60361746-60361768 AGAGTTTGGAAGGAGGGCTTGGG - Intronic
1084420484 11:69058190-69058212 AGAGCTGGGAGAGGTGGGTGCGG + Intronic
1084493512 11:69490834-69490856 AGAGTCTGGAAAGGGAGGTGGGG - Intergenic
1085305348 11:75482605-75482627 AGAGTTTGGATTGGAGGGATGGG - Intronic
1086143888 11:83529293-83529315 AGAGTTGGGAAAGCTGGGTCAGG - Intronic
1086469831 11:87096318-87096340 AGAGTTTGGAAAGGCAGTCTTGG + Intronic
1086500129 11:87444341-87444363 AGAGTTTGGGAAGGTGAGAAGGG - Intergenic
1088565965 11:111173383-111173405 AGAATTTGAAAAGGCAGGTTGGG + Intergenic
1088621180 11:111685540-111685562 AGAGTTTCGAAAGGATGGTTAGG + Intronic
1089609723 11:119662669-119662691 AGAGTGTTGTAAGGTGGGATGGG + Exonic
1090037862 11:123264317-123264339 AGAGTGTACAATGGTGGGTTTGG + Intergenic
1090351610 11:126111698-126111720 AGAGGTTGGGAAGGTGGCCTGGG + Intergenic
1090398399 11:126433945-126433967 AGCGTGTGGAAACGTGGGCTGGG - Intronic
1091382164 12:68786-68808 AGAGTTAGAGAAGTTGGGTTAGG + Intronic
1091712385 12:2751203-2751225 AGAGTTAGAGAAGTTGGGTTAGG - Intergenic
1093167197 12:15817699-15817721 CGATTTTGGAAAGGTTGGGTTGG + Intronic
1093503974 12:19843462-19843484 AGAGGTTGGAAAGATTGGTGGGG + Intergenic
1094212579 12:27908051-27908073 AGAGTTTGGAAAAGTAGGTTAGG - Intergenic
1094795072 12:33962284-33962306 AGAGTATGGAACAGTGTGTTTGG + Intergenic
1095075143 12:37911255-37911277 AGAGTCTGCAAAGGTATGTTTGG - Intergenic
1096405353 12:51340070-51340092 AGAGTTTGGGAAGGTGTGGCAGG - Intronic
1096772908 12:53947796-53947818 AGAGGTTGGGATGGTGGGTGGGG - Intergenic
1096861908 12:54535220-54535242 AGATTTGGGAAAGGAGGGCTTGG + Intronic
1097065285 12:56316069-56316091 AGAGTTTGGAGGGGCGGGTTTGG - Exonic
1098354189 12:69595035-69595057 ATAGGTTGGAAAGTTGGTTTGGG + Intronic
1098536709 12:71601398-71601420 AAAGCTTGGAAATGTGGGTTAGG - Intergenic
1099123805 12:78727089-78727111 AGAGCATAGAAAGGTGAGTTTGG - Intergenic
1099160556 12:79236310-79236332 AGAGGCTGGAAAGGTAGGTTGGG - Intronic
1099241360 12:80143004-80143026 AGAGGTGGGAAAGATGGGCTGGG + Intergenic
1101330233 12:103751518-103751540 AGAGGTTTGAAAGCTTGGTTGGG + Intronic
1101341888 12:103849483-103849505 ATAGTTTGGTAGGGTGGGGTGGG - Intergenic
1101427905 12:104602926-104602948 AGAGATTGGGAAGGGGGGTAGGG - Intronic
1101533308 12:105594670-105594692 AGAGTTTTGAAAGGTTAGTGTGG - Intergenic
1101567909 12:105926654-105926676 AGAGTATAAGAAGGTGGGTTTGG + Intergenic
1102450282 12:113036983-113037005 AGGGTGGGGACAGGTGGGTTTGG - Intergenic
1102650378 12:114438022-114438044 AGGCTTTGGAAAGGTGGATAGGG + Intergenic
1102760139 12:115377628-115377650 AGAGGTTGGAAAGGTGGGGTGGG - Intergenic
1102923596 12:116810587-116810609 GTAGTTTGGAAAGGTGGGTCAGG - Intronic
1103889162 12:124225515-124225537 GGAGTGTGGAGAGGTGGGTAGGG + Intronic
1104052877 12:125208227-125208249 AGAGTTGGGGAAGGTGGGCAGGG + Intronic
1104421386 12:128638614-128638636 ACAGCTTGGAAAGGTGGTTACGG + Intronic
1104480411 12:129103061-129103083 AGAGCATGGAAGGGTGGATTTGG - Intronic
1104534359 12:129604585-129604607 AGAGGCTGGAAAGTTGGGTCAGG - Intronic
1104623522 12:130336085-130336107 AGGATTTGGGAAGGTGGCTTGGG + Intergenic
1105478484 13:20750349-20750371 AGAGGCTGGGAAGGTGGGGTGGG - Intronic
1105738465 13:23297085-23297107 ATAGTCTGGAAAGGTTAGTTTGG - Intronic
1107156051 13:37168009-37168031 GGAGCTTAGAACGGTGGGTTAGG - Intergenic
1107286055 13:38793517-38793539 AGAGTTTGGAGAGGTGGGCGAGG + Intronic
1107498316 13:40950402-40950424 TGAGATTGGAAAGGTAGGTTTGG - Intronic
1107821050 13:44286040-44286062 TGAGTGTTGAAAGGTGGGTAAGG - Intergenic
1108155312 13:47578259-47578281 AGAGTTTGGAAAAGTTTGGTGGG - Intergenic
1108288373 13:48932034-48932056 AGAGAATGGAAGGGTGGGTTTGG - Intergenic
1108341613 13:49503238-49503260 AGAGGAGGGAAAGGTGGGGTGGG - Intronic
1108842014 13:54629713-54629735 ACATTTTGGAAAGATGGGCTAGG + Intergenic
1109711022 13:66160698-66160720 AGTGTATAGAAAGGTGGCTTTGG - Intergenic
1109911490 13:68917919-68917941 AGGGTTAGGAAAGCAGGGTTAGG - Intergenic
1110933587 13:81253814-81253836 AGAGTGTGGGAAGGTGGGCGGGG - Intergenic
1111739255 13:92182005-92182027 AGAGTATTGAGAGCTGGGTTGGG + Intronic
1111931310 13:94515810-94515832 AGAGAATGGAAAGTTGAGTTGGG + Intergenic
1113037883 13:106071042-106071064 AGGGGTTGGAGAGGTGGGGTAGG - Intergenic
1113156978 13:107334402-107334424 AGTGCTTGGAAAGGAGGGGTTGG - Intronic
1114367713 14:22047783-22047805 AGAATGGGGAAAGGTGGGTCAGG + Intergenic
1115270049 14:31541287-31541309 AAAGTTAGGAAAGCTGGGTGAGG - Intronic
1117313408 14:54550855-54550877 AAAGTATAGAAGGGTGGGTTTGG - Intergenic
1117376315 14:55121349-55121371 AGAGTTGGGAAAGGTGGGGCAGG - Intergenic
1117428191 14:55623017-55623039 AGAAATTGGAAGGGAGGGTTTGG - Intronic
1117882794 14:60328224-60328246 CGGCTTTGTAAAGGTGGGTTGGG - Intergenic
1117957509 14:61134053-61134075 AGAGTTAAGAATGGTGGTTTGGG + Intergenic
1118143561 14:63111597-63111619 ATAGTTTGGAAATGTGCCTTAGG - Intergenic
1118856755 14:69629168-69629190 AGGGTGTGGAAAGGAGGGGTTGG + Intronic
1119193142 14:72697888-72697910 AGAGGCTGGAGAGGTGGGTGGGG - Intronic
1119375402 14:74187222-74187244 AAAGTTTGGAAATGGGGGCTGGG + Intronic
1119957022 14:78809550-78809572 AGATTTTAGAGAGGTGGGGTCGG - Intronic
1120900441 14:89570634-89570656 AGAGTTTACAAATGTGTGTTGGG - Intronic
1120928917 14:89827530-89827552 AGAGTATAGAAGGGTGAGTTTGG + Intronic
1120949967 14:90031793-90031815 AGAGTTTGGTCAGGTGGGAGTGG - Intronic
1121692109 14:95885431-95885453 AGAGATAGGAAAGATGGGTTTGG + Intergenic
1121864218 14:97347407-97347429 AAAGTGTGGAGAGGTGGTTTGGG + Intergenic
1121879769 14:97489532-97489554 AGTGTTTGGAGAGGTGGAGTGGG + Intergenic
1124150084 15:27169453-27169475 TGGGTCTGGAAAGGTAGGTTAGG + Intronic
1124485099 15:30107085-30107107 AAAGTTTTTTAAGGTGGGTTTGG + Intergenic
1124518478 15:30390184-30390206 AAAGTTTTTTAAGGTGGGTTTGG - Intronic
1124540176 15:30576065-30576087 AAAGTTTTTTAAGGTGGGTTTGG + Intergenic
1124684646 15:31771763-31771785 AGAGGTTGGAGAGGGGGGTCTGG - Intronic
1124758475 15:32431512-32431534 AAAGTTTTTTAAGGTGGGTTTGG - Intergenic
1125136368 15:36348916-36348938 AGAGTTTGGAGAGGTGAATGTGG - Intergenic
1125603466 15:40927786-40927808 AGAGGTTGGGAGCGTGGGTTGGG - Intergenic
1126319575 15:47407669-47407691 AGTGTTTGGAAAGGAGGATTGGG + Intronic
1126456381 15:48866551-48866573 AGAGTTTAGACAGATTGGTTTGG - Intronic
1127240522 15:57108560-57108582 AGAGTTTGAGAATGTGGGTGAGG + Intronic
1127835263 15:62785675-62785697 AGTGTTTGGCAAGGGAGGTTTGG + Intronic
1128265432 15:66262340-66262362 AAAGGTTGGAAAGGTGAGCTGGG + Intergenic
1129316204 15:74746294-74746316 ACAGTATGGAAAGGTGGGAAAGG + Intergenic
1129964467 15:79721628-79721650 AGAGTTGGCAGAGGTGGGGTGGG + Intergenic
1131857748 15:96616797-96616819 AGAGTTTGGAAAGGGAGGAAGGG - Intergenic
1133936088 16:10270534-10270556 AGAGCGTGGAAAGGAGGGTAGGG - Intergenic
1134913427 16:18049839-18049861 AGAGTTTAGATAGGTGGATGGGG - Intergenic
1136119388 16:28121339-28121361 AGAGACTGGATAGGTGTGTTGGG - Intronic
1136456833 16:30384579-30384601 AGAATCTGGAAAGGGGGGCTGGG + Intronic
1137920397 16:52481970-52481992 AGATTTTGGAATAGTTGGTTGGG - Intronic
1138133552 16:54502122-54502144 AGAGTTGGAGAAGGTGGGTGGGG + Intergenic
1138745008 16:59353272-59353294 AGTGTTTCGAAAGGTTGTTTTGG + Intergenic
1139523121 16:67496730-67496752 GGAGTTAGAAATGGTGGGTTAGG - Intergenic
1139951732 16:70675728-70675750 AGATTTTGAGAAGGTGGTTTAGG - Intronic
1139968894 16:70761582-70761604 GGAGTGTGGAAAGGTGTGTGTGG + Intronic
1140300091 16:73749088-73749110 GTAGTTTAGAAAGGTGAGTTTGG - Intergenic
1141475655 16:84271551-84271573 ACAGTCTCGAAAGGTAGGTTAGG + Intergenic
1142018119 16:87762897-87762919 TGAGGTTGGAGAGGTGGGTGTGG - Intronic
1143230299 17:5348313-5348335 GGAGTTTTGGAAGGTGGGTAGGG + Intronic
1143332729 17:6149381-6149403 GGAGTTTGGAAAGGTGAGGCTGG - Intergenic
1145867027 17:28248019-28248041 AGGGTTTGAAAAGGTGTGGTGGG + Intergenic
1145898693 17:28475789-28475811 AGAGTCAGGAAAGGTGGGAAGGG - Intronic
1146557535 17:33839484-33839506 AGAGTGTAGAAGGGTGAGTTTGG - Intronic
1147862034 17:43529463-43529485 AAACTTTGGAAAGGAGGGCTGGG + Intronic
1148204193 17:45769300-45769322 TGAGATTGGAAAGCTGGGCTGGG - Intergenic
1148450953 17:47777606-47777628 AGAGCTGGGAAAGGAGGGTGAGG - Intergenic
1148849574 17:50548149-50548171 ATGGTTCAGAAAGGTGGGTTGGG + Intronic
1151090450 17:71433661-71433683 AGATTTTAGAAAGGTGGCTAGGG - Intergenic
1151329841 17:73400323-73400345 AGCGTGTGGAAGGGTTGGTTGGG - Intronic
1152010335 17:77709214-77709236 GGAGTTTGGAAAAGTGGCCTAGG + Intergenic
1152119118 17:78407186-78407208 AGAGTTGGCAGAGGTGGGTGAGG + Intronic
1152583465 17:81179111-81179133 AGAGTTCTGGAAGGTGGGTCAGG - Intergenic
1152811277 17:82383956-82383978 AGATTTTGTAAATTTGGGTTTGG + Intergenic
1153351053 18:4081532-4081554 AGAGGATTGAAAGGTGGGTGAGG - Intronic
1153483528 18:5572289-5572311 ACAGTTGACAAAGGTGGGTTGGG - Intronic
1155622399 18:27794731-27794753 GGAGTTTGGACATGTGGGATGGG - Intergenic
1155707805 18:28838091-28838113 ACAGATGGGAAAGGTGGGGTTGG - Intergenic
1156053514 18:32969458-32969480 AGAGGTTGGAAAGTGGGTTTAGG - Intronic
1156501606 18:37563632-37563654 AGAGATTGGAAAGGTGGAACGGG - Intronic
1157381927 18:47226330-47226352 GGAGTTTGGAATGGTGGAATTGG + Intronic
1158455610 18:57604641-57604663 ATACTTTGGAAAGCTGGGGTGGG + Intronic
1158850898 18:61495383-61495405 AGAGTATGGAAAGGTGAGCATGG - Intronic
1159276583 18:66230519-66230541 AGAGTGAGGTAAGGTGGTTTTGG - Intergenic
1160090696 18:75824056-75824078 AGCGTTTGGGAAGATGGTTTTGG + Intergenic
1161196573 19:2989773-2989795 AGAGTGTGGTCAGGTGCGTTTGG + Exonic
1161566947 19:5008027-5008049 ATGCTTTGGAAGGGTGGGTTGGG + Intronic
1161939477 19:7393983-7394005 AGACTTCAGAAAGGTGGGTCTGG - Intronic
1162315957 19:9937991-9938013 AGAGATGGGCAAGGTGGTTTGGG + Intergenic
1162722093 19:12668671-12668693 GGTGTCTGGAAAGGTGGCTTCGG - Intronic
1163297948 19:16424484-16424506 AGAGTTTTGAAAGTCAGGTTAGG - Intronic
1164155444 19:22593796-22593818 AGAGTTTGGAAACCTGCCTTGGG + Intergenic
1164337397 19:24341701-24341723 AGAATCTGCAAAGGTGTGTTTGG + Intergenic
1164369034 19:27625179-27625201 AGAGGTTGGAAAGATGCTTTAGG + Intergenic
1164576919 19:29410584-29410606 AGAGTGTGGAAAGATGGGGAGGG + Intergenic
1164700250 19:30279867-30279889 AGAGTTGGGCAAGGAGGATTTGG - Intronic
1164990246 19:32677349-32677371 ACAGTTTGAAAAGGTGGGTGGGG + Exonic
1166626244 19:44358794-44358816 AGAGTGAAGAATGGTGGGTTTGG - Intronic
925194836 2:1914563-1914585 AGGGTTTGGGAAGGTGGCTCTGG - Intronic
925367205 2:3318734-3318756 AGAGTTTGGAACGGTGTGTGAGG - Intronic
926782205 2:16483623-16483645 TGAGTTTTGCAAGGAGGGTTTGG + Intergenic
928481101 2:31684459-31684481 AGAGAGTGGAATGGTGGGCTGGG + Intergenic
928494353 2:31816731-31816753 TGAGGTTGGAAAAGTGGGTCTGG - Intergenic
928734124 2:34266004-34266026 AGAGTTTGGAAGGGAGGTTAAGG + Intergenic
928852419 2:35766157-35766179 AGACTTTGGTATGGTGGGTTGGG + Intergenic
929581299 2:43083111-43083133 AGAGTTTGGGAATGTGGGAGTGG - Intergenic
930277130 2:49324780-49324802 ATATTTTGTAATGGTGGGTTTGG - Intergenic
930357868 2:50344900-50344922 AGAGTGTGGGTAGGTGGGTGTGG - Intronic
931040937 2:58299124-58299146 ATATTTTGGAAATGTGGCTTTGG + Intergenic
931361253 2:61579707-61579729 AGAGTTGGGAAATGTGGCTTAGG - Intergenic
931559779 2:63547801-63547823 AGAGGCTGGGAAGGTGGGGTGGG + Intronic
931639487 2:64369587-64369609 AGTGTTTGCAAAGCTGGGGTGGG - Intergenic
931642246 2:64392185-64392207 CCAGTGTGGAAAGGTTGGTTTGG + Intergenic
932556977 2:72833129-72833151 AGAGATTGGCAATGTGGGTATGG - Intergenic
932866840 2:75352512-75352534 AGAGTGGGGAAAGGTGGGTGGGG + Intergenic
933767751 2:85721885-85721907 GGAGTTTGGGAAAGGGGGTTCGG + Intergenic
934764226 2:96871267-96871289 AGAGCTGGGAAACGTGGCTTTGG - Intergenic
935539109 2:104328296-104328318 ATAGTATGGAAAGGTGGGGGCGG + Intergenic
935929229 2:108105370-108105392 ACAGTGTGGAAAGGGGGGATTGG + Intergenic
936063593 2:109313892-109313914 AGATATTTGAAAGGTGTGTTGGG + Intronic
937042482 2:118833269-118833291 AGGGAGTGGAAGGGTGGGTTTGG + Intergenic
937603803 2:123772557-123772579 GGAGTTTGGAAACATAGGTTGGG + Intergenic
938049853 2:128158990-128159012 TGAAGTTGGAAAGGTGGGCTGGG + Intronic
938141541 2:128798734-128798756 GGAGTATGGAAGGGTGGGCTTGG + Intergenic
938314199 2:130315086-130315108 AGAGTGTGGAAAGGAGTGTGGGG - Intergenic
938401838 2:130999632-130999654 AGATTTAGGAAAAATGGGTTAGG - Intronic
939425522 2:142031681-142031703 AGAGTTTGGAAAGGCAGCTGCGG - Intronic
940954697 2:159714136-159714158 AGAGTTGTGTAAGGTGGGTATGG - Intronic
941312475 2:163951374-163951396 AGAGTATGGAAAGTTAGGTATGG + Intergenic
943916289 2:193637167-193637189 AGATTTAGGAAGGGTGGGATTGG - Intergenic
944534133 2:200693503-200693525 GGAGCTTGGACAGGTGAGTTGGG - Intergenic
946880866 2:224176021-224176043 AGAGTTAAGAAGGGTGTGTTTGG + Intergenic
947378208 2:229519213-229519235 TAAGATTGAAAAGGTGGGTTGGG - Intronic
947905317 2:233757129-233757151 TGAGCTTGGACAGGTGGGCTGGG + Intronic
1168786566 20:544598-544620 GGAGGCTGGAAAGGAGGGTTTGG - Intergenic
1169489771 20:6061501-6061523 AGAGATTGGAAAGGTTATTTGGG + Intergenic
1171096780 20:22339988-22340010 AGGATATAGAAAGGTGGGTTTGG - Intergenic
1171116239 20:22527025-22527047 AGACTTGGGGAAGGTGGTTTGGG + Intergenic
1171467455 20:25340013-25340035 ATAGTTTTGAAAGGGGGTTTGGG - Intronic
1171876110 20:30578357-30578379 AGAGTGAAGAATGGTGGGTTTGG + Intergenic
1172701480 20:36856065-36856087 AGAGTCTGGGAAGGGGCGTTGGG - Intronic
1173029613 20:39342680-39342702 AGACTCTGAAGAGGTGGGTTGGG + Intergenic
1173214881 20:41071700-41071722 ACACTCTGGAAAGGTGGCTTTGG + Intronic
1173305482 20:41843863-41843885 AGAGACTGGAAAAGTGAGTTGGG + Intergenic
1173881388 20:46415262-46415284 AGGGTATGGAAAGGTAGGTTTGG + Intronic
1174074382 20:47922329-47922351 TGATTTTGGAAAGTTGGTTTGGG + Intergenic
1174324859 20:49771053-49771075 AGAGTTTGCAAAGGTGGAAATGG + Intergenic
1174384572 20:50179467-50179489 TGGGTTGGGGAAGGTGGGTTGGG + Intergenic
1174669583 20:52294029-52294051 AGAGTTTGGAAAAGAGGATATGG + Intergenic
1174846198 20:53945550-53945572 AGGGTTTGGGATGGGGGGTTGGG - Intronic
1175609986 20:60342762-60342784 AGAGGTTAGAGAGGTGGGTAAGG - Intergenic
1175838328 20:62010662-62010684 GGAGTAAAGAAAGGTGGGTTTGG - Intronic
1176049760 20:63112535-63112557 ATAGGTGGGAATGGTGGGTTAGG + Intergenic
1176283036 20:64326047-64326069 AGAGTTAGAGAAGTTGGGTTAGG - Intergenic
1176983395 21:15408643-15408665 ATTGCTTGGAAAGATGGGTTAGG + Intergenic
1180738751 22:18038339-18038361 AGAGTTAAGAAAAGTGGGCTGGG + Intergenic
1180800025 22:18627360-18627382 AGAGTTGTGAAGGGTGGGTTTGG + Intergenic
1181221690 22:21367906-21367928 AGAGTTGTGAAGGGTGGGTTTGG - Intergenic
1182097838 22:27638069-27638091 AGGGTTTGGGAAGGTGGTCTGGG - Intergenic
1182191194 22:28462547-28462569 ATAGGTTGGAAAGGTGGGGATGG - Intronic
1183257519 22:36771935-36771957 AGAGAGTGGGAAGGTGGGTTAGG - Intronic
1183316292 22:37138832-37138854 AGGGATAGGCAAGGTGGGTTTGG + Intronic
1183810248 22:40250352-40250374 AGAGTTTGGAAATGATGATTAGG - Intronic
1184929988 22:47673818-47673840 AGAGCTTGGAAGGGTGGGGAGGG + Intergenic
950435234 3:12975356-12975378 AGAGTTGGGAAAGGAGGCTTAGG - Intronic
951233045 3:20201666-20201688 AGAGTTTGATTAGGTGAGTTGGG - Intergenic
952026892 3:29093506-29093528 GGAGGAGGGAAAGGTGGGTTAGG - Intergenic
952236526 3:31486214-31486236 AGAGTTTGGAAAGAGAGGTAGGG - Intergenic
954269658 3:49497635-49497657 ACAATTTAAAAAGGTGGGTTTGG - Intronic
954367454 3:50154243-50154265 TGACCTTGGAAAGTTGGGTTGGG + Intergenic
954915025 3:54141403-54141425 AGGTTTTGGACAGGTTGGTTGGG - Intronic
955536682 3:59930881-59930903 AGATCTGGGAAAGGTAGGTTGGG - Intronic
955916664 3:63913375-63913397 AGCGCTTGGAAAGTTTGGTTTGG + Intronic
956077135 3:65517447-65517469 AGTGTTTGGAAGGGTAGATTTGG - Intronic
956192615 3:66621958-66621980 GGAGTTGGGAGAGGTGGGGTTGG + Intergenic
957535916 3:81503339-81503361 AGACTTTTGAAGGCTGGGTTAGG + Intronic
957698067 3:83669631-83669653 ATAGTTGGGAATGGTGGGTTGGG - Intergenic
958959497 3:100495479-100495501 AAAGTTTGGAAAGGTGGGAGAGG + Intronic
959902148 3:111673527-111673549 TGTGTATGGAAAGGTGGTTTGGG + Intergenic
961430534 3:126879285-126879307 AGAGTTAGGACATGTGGGTTGGG + Intronic
962816464 3:139005568-139005590 AGAGGTTGGAGAGGTGAGCTGGG + Exonic
962817960 3:139019964-139019986 AGAGGTTGGAGAGGTGAGCTGGG + Exonic
962820459 3:139043923-139043945 AGAGGTTGGAGAGGTGAGCTGGG + Exonic
962825267 3:139095355-139095377 AGGGTTGGGTCAGGTGGGTTGGG + Intronic
964717789 3:159741000-159741022 AGTGTTGGGAAAGGGGAGTTGGG - Intronic
966819331 3:183912651-183912673 AGTGTTTGCAAAGATGTGTTAGG + Intergenic
967083087 3:186068774-186068796 AGAGTTTAGGAAGGTGGTTGTGG + Intronic
967226817 3:187299791-187299813 AGAGCTTGGGAGGGTGGGATAGG - Intergenic
968300687 3:197611618-197611640 AGAGTCTGGAAAGGGTAGTTGGG + Intergenic
969328111 4:6455646-6455668 GGAGTTTGGAAAGGAGAGTAGGG - Intronic
969571358 4:8010517-8010539 AGAGCTTGGAAATTTGGGATTGG + Intronic
970810376 4:20086594-20086616 AGAATTTAGAAGGGTGGATTTGG - Intergenic
971201616 4:24514453-24514475 AGAGGTTGGAGAGGTGGATAAGG - Intergenic
971233244 4:24817889-24817911 TGAGGTTGGAAAGGTAGGCTAGG + Intronic
971486580 4:27166624-27166646 AGAGTTTAAAAAGCTGGGTGTGG + Intergenic
972693695 4:41423861-41423883 AGAGAAGGGAAAGGTGGGTTGGG + Intronic
972862634 4:43189898-43189920 TGAGTTTGGAAAGCTGGGCAGGG - Intergenic
973681510 4:53325060-53325082 GGAGTATTGCAAGGTGGGTTAGG - Intronic
974837053 4:67263858-67263880 AGAGTCAGGAAAGGTGTTTTAGG + Intergenic
975006586 4:69296220-69296242 AGGGTTTCAAAAGGTGGGGTGGG + Intronic
975292987 4:72698669-72698691 AGAGTTTGAGAAGTTGGTTTTGG + Intergenic
975645660 4:76543277-76543299 TGAGTCTTGAAAGGTGAGTTAGG + Intronic
976073671 4:81272422-81272444 AGAGTTTGGCTAGGTGGTTCTGG + Intergenic
976672467 4:87668807-87668829 AGAGATTGGAAAGGTGAGCTGGG + Intergenic
977733678 4:100384375-100384397 AGATTTGAGAAAGGTGGGTGCGG + Intergenic
980295773 4:130914277-130914299 AGAGTTTACAAAAGTGGGGTAGG - Intergenic
981747360 4:148064329-148064351 AGATTTGGGGAAGGGGGGTTGGG + Intronic
982215144 4:153076231-153076253 AGGGTTTGGAAAGGAGAATTAGG - Intergenic
982507764 4:156241337-156241359 AGAGTCTGGAAATATGGGATGGG - Intergenic
982923130 4:161302002-161302024 AGAGTTTGGCAAGGTGGGGAAGG - Intergenic
983906791 4:173191489-173191511 AAAATATAGAAAGGTGGGTTTGG + Intronic
984328140 4:178279884-178279906 AGAAATTGGACAGGTGGATTTGG - Intergenic
984633004 4:182080155-182080177 AGAGTTTTGAAACGTGGGTTAGG - Intergenic
984886568 4:184455154-184455176 AGAGGTTAGAAAGGTGGGATGGG - Intronic
985415469 4:189731999-189732021 AGAGTTTGGGAAAATGGGATAGG - Intergenic
986081600 5:4400329-4400351 AAATTTTGTAAAGGTGCGTTAGG - Intergenic
986804598 5:11297744-11297766 AGAGTTTGGACAGGAGGAGTGGG + Intronic
987122591 5:14781114-14781136 TGAGTTTTGAAAAGTGGCTTGGG + Intronic
987547648 5:19333573-19333595 AGAGTCTGGAGAGGTAGGATAGG - Intergenic
989183896 5:38604458-38604480 ACATTTTGGAAAGCTGAGTTGGG + Intronic
989425138 5:41287988-41288010 AGAGTCTGGAACGGTGGGTTGGG - Intergenic
989518270 5:42369695-42369717 AGAGTTTGGACACGTAGTTTTGG - Intergenic
989856455 5:46300187-46300209 AGAATCTGCAAAGGTAGGTTTGG - Intergenic
990487524 5:56273812-56273834 AGAGTATAGAAAGGTGGGCTTGG + Intergenic
992073559 5:73170801-73170823 GAAGTTTAGAAAGGTGGGTTTGG + Intergenic
992367164 5:76104656-76104678 AGAATGTAGAAAGGTAGGTTAGG - Intronic
992465439 5:76999586-76999608 GGAGTTTGGAATGGAAGGTTGGG + Intergenic
994266767 5:97726033-97726055 AGAGTTTGGAAAGGCAGTTGGGG - Intergenic
994572723 5:101535009-101535031 AGAGGTTGGAAAGAGAGGTTTGG + Intergenic
994955726 5:106529214-106529236 AAAGTATGGAAAGGTGGGAAGGG + Intergenic
995135144 5:108672595-108672617 TGAGGTTGGAAAGGTGGTTTGGG + Intergenic
995454372 5:112336083-112336105 AGGGTTTGGATAAGTGGGATGGG + Intronic
995657544 5:114443887-114443909 AGTGTCAGGAAAGGTGGGTTGGG + Intronic
995767103 5:115630439-115630461 ACACTTTGCAAAGGTGGGTATGG + Intronic
996200103 5:120661952-120661974 AGAGCTTGGAAATGTGGGCTGGG + Intronic
996687310 5:126297066-126297088 AGAGTTTGGGAAGATGGGGAAGG - Intergenic
997013949 5:129908159-129908181 AGAGCTTGGAAAGCTGGGACTGG + Exonic
997189962 5:131922699-131922721 AGAGGTAGGAAAGGTGGGGATGG - Intronic
998675288 5:144401008-144401030 AAAGTTTGGAAAGGTAGGCAGGG + Intronic
998830436 5:146152241-146152263 AGTGTTGGGAAAGGTGTGTGTGG - Intronic
999478455 5:151923788-151923810 AGAGTTTGGAAAGGTGGGTTGGG + Intronic
999673891 5:153980308-153980330 AGGGTTTGGAAAGCTATGTTAGG + Intergenic
999739445 5:154538965-154538987 ATACTTGGGAAAGTTGGGTTTGG - Intergenic
1000039861 5:157477545-157477567 TGACTTTGGAAATGTGGGCTTGG + Exonic
1001275916 5:170351472-170351494 AAAGTTTGGAAGGGAGGGTGTGG - Intergenic
1001495800 5:172187321-172187343 GGGGCTTGGAAAGGTGGGTTGGG - Intronic
1001777942 5:174343292-174343314 ATATTCTGGAAAGGTGTGTTAGG + Intergenic
1003085310 6:3055718-3055740 AGAGTTTGGAGAGGGGTCTTGGG - Intergenic
1004366058 6:15013673-15013695 AGAGTCTGAAAAGATGGGTCAGG - Intergenic
1005229687 6:23685608-23685630 AGAGTTTGGAACAGTGTGCTAGG - Intergenic
1006099887 6:31680118-31680140 AGAGATGGGACAGATGGGTTTGG - Intronic
1006171863 6:32097754-32097776 AGAGGGTGGAGAGGTGGGGTGGG - Intronic
1006400910 6:33816762-33816784 AGAGACTGGAAAGGTGGGGATGG - Intergenic
1007256363 6:40532047-40532069 TGAGATTGGAAAGGTAGGTGGGG - Intronic
1007484950 6:42174573-42174595 TGAGTTTGGGACTGTGGGTTTGG + Intronic
1007536165 6:42591503-42591525 AGAGTTTCAAAAGGTTGGTTGGG - Intronic
1008232948 6:49007595-49007617 GGAGTTTGGAAAAGTTGGTTGGG - Intergenic
1008381393 6:50842694-50842716 AGAGGTTGGAGAGGTGGGAGGGG + Intronic
1008482892 6:52005383-52005405 TAGGTTTGGAAAGGTGGGCTAGG - Intronic
1008513838 6:52301095-52301117 ACTGTTTGGCAAAGTGGGTTGGG - Intergenic
1008872807 6:56291596-56291618 AGAGCTTAGGAGGGTGGGTTTGG + Intronic
1009707431 6:67270725-67270747 AGAGTTTTGACAGGTGTGATTGG - Intergenic
1010289231 6:74116091-74116113 AGAGTAAAGAAATGTGGGTTTGG + Intergenic
1010899780 6:81412274-81412296 AGAGTTAGGAATGGTGGATAAGG + Intergenic
1011010148 6:82694792-82694814 AGAGTATGGAAATGCAGGTTAGG + Intergenic
1011038330 6:83002039-83002061 AGGGCTTGGGAAGGTGGGGTGGG - Intronic
1013019624 6:106200230-106200252 AGAATTAGGAACAGTGGGTTTGG - Intronic
1013217959 6:108047379-108047401 CGAGTTTAGAAAGGTGGCTATGG + Intronic
1015266266 6:131294994-131295016 GGAGCTTGGAGAGGTGAGTTAGG + Intergenic
1015860590 6:137674910-137674932 AGAGTTTGAAAAGTATGGTTAGG + Intergenic
1017223429 6:151992639-151992661 TGAGGTTGGCAAGGTGGGTGGGG + Intronic
1018211554 6:161487457-161487479 TGGGTTTGGAAAGGTTAGTTTGG + Intronic
1019873693 7:3790431-3790453 ATAGTGTGGAAAGGTGGGTTTGG + Intronic
1021853162 7:24828270-24828292 AGAGTTTGGAAGGCTGAGGTAGG - Intronic
1022073716 7:26944665-26944687 CGAGTATGCAAAGCTGGGTTGGG - Intronic
1022208203 7:28182585-28182607 AGAGTGTGGAGAGGTGGTTCAGG + Intergenic
1022671197 7:32457853-32457875 AGGGGTTGCAGAGGTGGGTTGGG + Intergenic
1023956937 7:44894072-44894094 AGAGGTTGGGAAGCTGCGTTAGG + Intergenic
1026884831 7:73934168-73934190 AGAATATAGAAAGGTGGGTCTGG - Intergenic
1027655614 7:80926987-80927009 ACAGTGTGGAAGGGTGGCTTGGG + Intergenic
1028155323 7:87422780-87422802 AGAGTTTTAAAAGATGGGTAGGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028794695 7:94889964-94889986 AGAATCTGGAGAGATGGGTTAGG - Intergenic
1029423563 7:100483826-100483848 AGGGTGTGGAAGGGTGGGTTTGG + Intergenic
1029805557 7:102992285-102992307 TGTGTTTGGAAAGGTGGGTTGGG - Intronic
1030154944 7:106445433-106445455 AGAGTTTGGGAAGGGGAGTAGGG - Intergenic
1030154962 7:106445505-106445527 AGAGTTTGGGAAGGGGAGTAGGG - Intergenic
1030641051 7:112006893-112006915 AGTGTGTGGAGAGTTGGGTTGGG - Intronic
1030933197 7:115551205-115551227 ACAGTGGGGAAAGGTGGGTTTGG - Intergenic
1033208077 7:139439464-139439486 CGAGGTTTGAAAGGTGGGTGAGG + Intergenic
1033225479 7:139559184-139559206 GGAGAGTGGAAAGGTGGGTTGGG + Intergenic
1036824154 8:11963343-11963365 AGAGTTTGGGGAGATGGGGTTGG + Intergenic
1036890335 8:12592543-12592565 AGAGTTAGGACAAGAGGGTTGGG - Intergenic
1037190441 8:16118440-16118462 ACAATTTGGAAACGTGGGCTGGG + Intronic
1037579001 8:20233683-20233705 AGAGTGGGGGAAGGTGGGCTCGG - Intergenic
1039004711 8:33021538-33021560 AGAGTTTTGAAAGGTGGGTGTGG + Intergenic
1039315740 8:36369626-36369648 AAAGTGGGGAAAGGTGGGTCTGG - Intergenic
1039850679 8:41362448-41362470 AAAGTTTGGGAAGGAGGGTTGGG - Intergenic
1041354871 8:56989798-56989820 AGAGATTGGAAAGGTAGGTAGGG - Intronic
1041504009 8:58573780-58573802 AGAGTCTAGAAGGGTGGATTTGG + Intronic
1041921852 8:63190901-63190923 AGAGCTGTCAAAGGTGGGTTAGG - Intronic
1042509772 8:69598750-69598772 AGAGTGTGGAAAAGAGGGTGTGG - Intronic
1042737313 8:72004085-72004107 AGAGTTTGGGAAAGTGCATTGGG + Intronic
1044027303 8:87189376-87189398 ACAGTTTTTAAAGGGGGGTTGGG - Intronic
1044205305 8:89486327-89486349 AGAGGCTGGAAAGTTAGGTTGGG + Intergenic
1044407822 8:91850159-91850181 AGAATCTGGAAAGGGTGGTTGGG + Intergenic
1044549995 8:93501322-93501344 AGAGTTTGGAGTAGTGGGATTGG - Intergenic
1044794222 8:95880111-95880133 AGAGTTTTAGAAGGTGGGTGTGG + Intergenic
1045054340 8:98356349-98356371 AGAGTTTGGTTAGGGGAGTTTGG + Intergenic
1045161685 8:99554653-99554675 AGATTTGGGAAAGGGGAGTTTGG + Intronic
1046029659 8:108768387-108768409 AGAGATTGGAAAAGTAGGTGAGG - Intronic
1046051347 8:109026220-109026242 AGAGTTTAGAAAGGGAGCTTTGG - Intergenic
1046779760 8:118202564-118202586 GGAGTTAGGAAAGGTGGGGCGGG - Intronic
1046899302 8:119506594-119506616 AGAGTTTGGAAAGGTCTTCTGGG + Intergenic
1047653265 8:126947666-126947688 ATAGATTGGAAAGTTGGGATTGG + Intergenic
1048952298 8:139506375-139506397 GGAGTGGGGAGAGGTGGGTTGGG + Intergenic
1049148193 8:141017377-141017399 AGAGTTGAGAAAGATGGGTGAGG - Intergenic
1049484654 8:142848782-142848804 AGAGTTTTCAAGGGTGGGATGGG + Intronic
1049979715 9:892848-892870 AGAGTTTGGAATGATGGGCAGGG - Intronic
1049994626 9:1023363-1023385 AGATTTTGGAATGCTGGGTCTGG - Intergenic
1050463253 9:5894850-5894872 AGAGCATAGAAAGGTAGGTTTGG + Intronic
1051786485 9:20750207-20750229 AGAGTTTAAAAAGGTGATTTGGG + Intronic
1053428211 9:38025034-38025056 GGAGTTTGGAAACATGGGTTGGG - Intronic
1055574160 9:77646204-77646226 AGTGCTTGGAAATGTGGGCTGGG - Intronic
1056225266 9:84489118-84489140 TGAGGTTGGAAAGGTGGGTAGGG + Intergenic
1056376077 9:86012401-86012423 AGAGAGTGGAAAGTTGGGTCGGG - Intronic
1056566457 9:87776975-87776997 AGAGTTGGGAACTGTGTGTTGGG - Intergenic
1056914237 9:90730708-90730730 GGAGTTTGGATAAGTGGGCTGGG - Intergenic
1058001090 9:99866005-99866027 AGAGTATGGAAAGGTAAATTAGG - Exonic
1059560007 9:115325086-115325108 AGTGTTTGGAAAGGGGAGCTGGG + Intronic
1060550470 9:124482576-124482598 TGTGTTTGGGAAGGTGGGTGAGG - Exonic
1061767624 9:132891835-132891857 AGTGTTTGGACAGGAGGGTATGG - Exonic
1062010087 9:134262183-134262205 AGAGTCTGGAGAGGAGGGTGGGG - Intergenic
1185602528 X:1350128-1350150 AGAGCTGAGAGAGGTGGGTTTGG + Intronic
1186938204 X:14474515-14474537 ATAGATTGGAAATCTGGGTTGGG + Intergenic
1187173763 X:16876167-16876189 AGAGATCGGAAGGGTGGATTGGG - Intergenic
1188034079 X:25297125-25297147 AGAGTTAGGGGAAGTGGGTTAGG - Intergenic
1189164920 X:38851337-38851359 AGGCTTTGGAAAGATGGCTTGGG + Intergenic
1189896988 X:45665827-45665849 AGAGTATGGAAATATGGGTGAGG - Intergenic
1190172044 X:48119499-48119521 AGAGTTGGGAGATGAGGGTTGGG - Intergenic
1190204449 X:48391834-48391856 AGAGTTGGAAAATGAGGGTTGGG - Intronic
1190206087 X:48403569-48403591 AGAGTTGGAAAATGAGGGTTGGG + Intronic
1190624224 X:52320893-52320915 AGAGTTTGGAAAGGTCGTTGGGG - Intergenic
1193822085 X:86177628-86177650 AGTATTTGGAAAGGAGGTTTTGG + Intronic
1194855432 X:98921898-98921920 ATAGCTTGGAAAGTTGTGTTGGG + Intergenic
1195446669 X:104959840-104959862 AGAGGCTTGAAAGATGGGTTTGG - Intronic
1196232589 X:113240897-113240919 AGAGGGTGGAAAGGTTGCTTGGG + Intergenic
1197410636 X:126111655-126111677 GAAGTGTGGAAATGTGGGTTTGG - Intergenic
1198763806 X:140061178-140061200 TGAGTTTGGAGAGGTGAGTAGGG + Intergenic
1200427380 Y:3036296-3036318 AGGGTTTGGAATGGGGGATTTGG - Intergenic