ID: 999481135

View in Genome Browser
Species Human (GRCh38)
Location 5:151949175-151949197
Sequence CAAGACTTCCTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999481127_999481135 26 Left 999481127 5:151949126-151949148 CCTATGTAGAGAGGGAATCTTAA No data
Right 999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999481135 Original CRISPR CAAGACTTCCTGAAGGAGGA AGG Intergenic
No off target data available for this crispr