ID: 999481422

View in Genome Browser
Species Human (GRCh38)
Location 5:151951619-151951641
Sequence TCACCATCTCACTTTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999481422 Original CRISPR TCACCATCTCACTTTACAGG TGG Intergenic
900754913 1:4426697-4426719 TCGACATCTCATTTTTCAGGAGG - Intergenic
901737964 1:11324251-11324273 TTCCCTTCTCACATTACAGGCGG - Intergenic
903468694 1:23569431-23569453 CAAACATCTCATTTTACAGGTGG - Intergenic
907458650 1:54592348-54592370 TCAGCACCCCACTTTACAGATGG - Intronic
907972525 1:59397643-59397665 GCACCATCCCACTTCACAGGTGG + Intronic
908659492 1:66421750-66421772 TGACCATCTCACTGTATCGGGGG + Intergenic
909511803 1:76461821-76461843 TTACCCTCTCATTTTACAGATGG + Intronic
915686552 1:157640040-157640062 TCACCACCTCACTGTGCTGGGGG + Intergenic
916343127 1:163758706-163758728 TTACCATCTCCCTTGACTGGGGG + Intergenic
916833961 1:168522846-168522868 TCAACTTCTCACTTTATAGGAGG - Intergenic
917012917 1:170495485-170495507 TCACCAGCTCATTTTACAAGTGG + Intergenic
919019743 1:192088706-192088728 TAACCATCTCACCATGCAGGTGG - Intergenic
920438553 1:205963609-205963631 TCACCCTCCCATTTTACAGAGGG - Intergenic
923051407 1:230393422-230393444 TCACCATCCCACCTTTAAGGAGG + Intronic
924376289 1:243412854-243412876 AAACCCTCTCACTTTACAGTTGG - Intronic
924786584 1:247205242-247205264 TCCATATCACACTTTACAGGTGG + Intergenic
924919036 1:248606660-248606682 TCTCCATCTCCCTCTCCAGGTGG - Intergenic
1062823285 10:550670-550692 TCTCCACCTGATTTTACAGGAGG - Intronic
1063549297 10:7014566-7014588 TTACCATCCCAGTTTACAGATGG + Intergenic
1064094362 10:12412188-12412210 CCACCAGCTCACACTACAGGTGG - Intronic
1074770881 10:116732951-116732973 CCACCCTCTCATTTTACAGATGG - Intronic
1074924633 10:118055232-118055254 TCACTTTCTCACCTTTCAGGGGG - Intergenic
1078438301 11:11343813-11343835 TCACCATTTCACCTTAGAGTGGG + Intronic
1079091368 11:17482633-17482655 TCACCATCTCTCTTTAAAGCAGG + Intergenic
1081403513 11:42669493-42669515 CCACCAGCTCACTTCACAGATGG - Intergenic
1084444465 11:69195724-69195746 TCCCCATCACACTTTCCAGATGG - Intergenic
1089906207 11:122041931-122041953 TTACCATCACACTTTGCACGGGG - Intergenic
1097516891 12:60617677-60617699 TCACCATTTCCCTTGACTGGGGG - Intergenic
1098412313 12:70199586-70199608 TTACCATGTCCCTTTACTGGGGG + Intergenic
1098850590 12:75591600-75591622 TCACCATTACATTTTACAGTTGG - Intergenic
1101423669 12:104569869-104569891 TCATAATCTTACTTTACAGTTGG + Intronic
1101848476 12:108383035-108383057 TCCCTCTCTCACTCTACAGGAGG - Intergenic
1103375265 12:120450781-120450803 TCACCATCCTTCTTTGCAGGAGG + Intronic
1104524209 12:129502833-129502855 TCACCATCTGACTCTAGGGGAGG - Intronic
1104788493 12:131467058-131467080 TCACCACCTCAGTCAACAGGAGG + Intergenic
1106716192 13:32390911-32390933 TTATCATCCCACTTTACAGATGG + Intronic
1111078379 13:83268725-83268747 TCACATTCTCATTTTAAAGGTGG - Intergenic
1113230933 13:108214581-108214603 TCAAGATCTCATTTTACAGCTGG - Exonic
1113700124 13:112378584-112378606 TCACCATCAGACTTCACATGTGG + Intronic
1114733033 14:25014538-25014560 TCAGCATCTCACAGTATAGGTGG - Intronic
1115419245 14:33174318-33174340 GCAGTATCTCACATTACAGGTGG + Intronic
1116671206 14:47845721-47845743 TCACCATCTCCCTTGGCTGGGGG - Intergenic
1120247615 14:82025451-82025473 TCACCATCTCACTTGGCGAGGGG + Intergenic
1121905769 14:97741474-97741496 TCACCACCTCCCTTTGCTGGAGG + Intergenic
1122288639 14:100667719-100667741 TCACCCACTCACGTTCCAGGAGG + Intergenic
1126228083 15:46294640-46294662 TCACCATCCCATTTTACAGATGG - Intergenic
1127805497 15:62516084-62516106 CAACCATCTCTTTTTACAGGTGG + Intronic
1128072382 15:64806039-64806061 TCTCCAACTCATTTTACAGGAGG + Intergenic
1128389798 15:67175186-67175208 TAATCATCTCACTTTAAAGCAGG - Intronic
1128559924 15:68658120-68658142 CCAACATCTCATTTTACAGATGG - Intronic
1131022263 15:89108968-89108990 TAACCTTCTCATTTTACAGATGG + Intronic
1133743138 16:8666605-8666627 TCATCATCCCATTTTACAGATGG + Intergenic
1134024743 16:10945035-10945057 GCATCCTCTCGCTTTACAGGTGG - Intronic
1135062800 16:19285471-19285493 TTACCATCCCATTTTACAGAGGG + Intergenic
1140182776 16:72736637-72736659 TCACCATCTCATTTGGCTGGGGG + Intergenic
1140579944 16:76218182-76218204 CCACCATCCCAGTTTAGAGGTGG - Intergenic
1140762106 16:78119019-78119041 TCAGCATCTCAGTATCCAGGGGG + Intronic
1141884467 16:86882339-86882361 GCACCATCTAACCTTCCAGGAGG - Intergenic
1142248892 16:88982202-88982224 TTACCTTCTTACTTTACAGTTGG - Intergenic
1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG + Intergenic
1144794088 17:17879191-17879213 TCAACATCACATTTTGCAGGAGG - Intronic
1145259716 17:21347427-21347449 TCACCTCCTCACTGCACAGGTGG + Intergenic
1145316899 17:21740521-21740543 TCACCTCCTCACTGCACAGGTGG - Intergenic
1147689566 17:42307091-42307113 TCATCCCCTCATTTTACAGGTGG - Intronic
1147832901 17:43309649-43309671 TCAGCTTCTCACTTCCCAGGAGG + Intergenic
1148618228 17:49015505-49015527 TCCCCATCTCAGATTGCAGGAGG + Intronic
1149560018 17:57601849-57601871 TCCTCATCTCATTTTACAGAGGG + Intronic
1153153689 18:2125110-2125132 TCACCATACCACCTTGCAGGAGG - Intergenic
1154930387 18:20988636-20988658 TCTCCAGCTCATTTAACAGGTGG + Intronic
1156471863 18:37382196-37382218 TTACCATCCCATTTTACAGATGG + Intronic
1157934947 18:51862628-51862650 TTACCATCTCTCTAAACAGGCGG + Intergenic
1158235811 18:55312291-55312313 TCACCATCTAACTTTAAAACAGG + Intronic
1161462091 19:4403394-4403416 TCACCCTCCCACGTTTCAGGAGG - Intronic
1163438673 19:17310473-17310495 TCACCATCCCACTTTTCAGGTGG - Intronic
1164134840 19:22405508-22405530 TCACCATCTCTCTTGGCTGGGGG - Intronic
1165355007 19:35299259-35299281 TCACCCTCTCGCTTTGCGGGAGG + Intronic
925671335 2:6312620-6312642 TATCAATCTCACTTTACAGGTGG - Intergenic
926354370 2:12026909-12026931 AGACCATTTCACTTCACAGGTGG + Intergenic
928188260 2:29135794-29135816 TCATCATCACTCTTTACATGTGG - Intronic
928409887 2:31046940-31046962 TCAAAATCTCCTTTTACAGGTGG + Intronic
928697303 2:33862165-33862187 TCACATTCTCAGTTTCCAGGTGG + Intergenic
928885809 2:36146841-36146863 TCACCTTTTCGTTTTACAGGTGG - Intergenic
931072532 2:58669299-58669321 TCACCATTTCATTTTACTGGAGG - Intergenic
932091797 2:68812377-68812399 TCAGCTTCTCCATTTACAGGAGG - Intronic
932903140 2:75723295-75723317 TCACCATCTCCCTTGGCAGGGGG + Intergenic
933160189 2:79015298-79015320 TCCCCATCTCACGTTACACCCGG - Intergenic
937428904 2:121821879-121821901 TGATCTTCTCACTTTACAGATGG - Intergenic
940558724 2:155266332-155266354 TCAGCAGGTCACTTCACAGGTGG - Intergenic
940592501 2:155748021-155748043 TCACCACCTCCCTTGACTGGGGG - Intergenic
941665806 2:168243273-168243295 TTACAATCTCATTTTACAAGAGG + Intronic
942513968 2:176732194-176732216 TCAACATCTCTTTTGACAGGGGG + Intergenic
944096196 2:195971267-195971289 TTACAGTCTCATTTTACAGGTGG - Intronic
945138604 2:206658675-206658697 CCAGCTTCTCACTTTGCAGGGGG - Intronic
945203089 2:207304635-207304657 TTACCATCTTACCTTACTGGGGG - Intergenic
1170881113 20:20297104-20297126 TCACCTTGTAACTTTACAGTTGG + Intronic
1171726200 20:28623293-28623315 TGACCATATTACTTTACATGGGG - Intergenic
1171751929 20:29060080-29060102 TGACCATATTACTTTACATGGGG + Intergenic
1171857313 20:30359047-30359069 TGACCATATTACTTTACATGGGG + Intergenic
1172173370 20:32958159-32958181 TCCCCATCTCAGTTCACATGTGG + Intronic
1174515673 20:51090627-51090649 TGACATTCTCACTTTACAGATGG + Intergenic
1176289654 21:5037343-5037365 CCAGCGCCTCACTTTACAGGAGG - Intronic
1179000186 21:37450443-37450465 CCCCCACCTCACTTTACAGAGGG - Intronic
1179867576 21:44226244-44226266 CCAGCGCCTCACTTTACAGGAGG + Intronic
1180391104 22:12282913-12282935 TGACCATATTACTTTACATGGGG - Intergenic
1180408636 22:12581840-12581862 TGACCATATTACTTTACATGGGG + Intergenic
1182546282 22:31078487-31078509 TAATCACCTCATTTTACAGGGGG + Intronic
1184076496 22:42182460-42182482 TCACCATCCCGGTTTACAAGAGG + Intronic
1184226621 22:43132527-43132549 TCACCTCCTCACTTGACAGCTGG - Exonic
1184813805 22:46855319-46855341 TGCCCATCTCACTAGACAGGTGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956731883 3:72203922-72203944 TCACAAGCTCACTTTCCAAGGGG - Intergenic
957168309 3:76704249-76704271 TCACACTCTCACTTTTCAGAGGG - Intronic
957745883 3:84341586-84341608 TAAACATCTCAATTTCCAGGAGG + Intergenic
958656560 3:97009810-97009832 TCACCACCTCACTTGGCTGGAGG + Intronic
961414480 3:126747362-126747384 CTATCATCTCACTTTACAGCTGG - Intronic
966527870 3:180940321-180940343 TTACCTTCAAACTTTACAGGCGG - Intronic
966638470 3:182161800-182161822 TCAACATCTCTCTTTTCAAGAGG - Intergenic
969616031 4:8253039-8253061 TCGCGATCCCACATTACAGGTGG - Intergenic
972284319 4:37633802-37633824 TGTCCTTCTCACTTTACAGAGGG + Intronic
972341901 4:38159352-38159374 TCACCATCTCACAGTTCAGGAGG + Intergenic
974117692 4:57600622-57600644 TCACAATCCCATTTAACAGGTGG + Intergenic
975602169 4:76113038-76113060 TCACCATCTCACATGGCAGAAGG + Intergenic
977142186 4:93387439-93387461 TCACCATCTAAATTTAAAAGGGG + Intronic
981079859 4:140628599-140628621 TTATCATCTCACCTTACAGAGGG - Intronic
982133847 4:152255257-152255279 GCACTATATCACTTCACAGGTGG + Intergenic
985434329 4:189914411-189914433 TGACCATATTACTTTACATGGGG + Intergenic
986235026 5:5901551-5901573 CCAATATCTCACTTTGCAGGGGG - Intergenic
988084184 5:26452799-26452821 GCACCATCTTCATTTACAGGTGG + Intergenic
995780453 5:115769798-115769820 CCACCATCTCAATGTAGAGGAGG + Intergenic
995907412 5:117142324-117142346 TCCAGATCTTACTTTACAGGAGG + Intergenic
996005783 5:118419582-118419604 TCACCATCTCCCTTGACTGGTGG - Intergenic
997433376 5:133856977-133856999 TTACCCACCCACTTTACAGGTGG - Intergenic
998452344 5:142244735-142244757 ACACCATCCCATTTTCCAGGTGG + Intergenic
998963069 5:147509376-147509398 TCTCCAGCTCACTTTGCACGGGG - Intronic
999481422 5:151951619-151951641 TCACCATCTCACTTTACAGGTGG + Intergenic
1001688304 5:173612694-173612716 TCACCATTACACTTTAGAGGTGG + Intronic
1005602722 6:27444099-27444121 TCACTTTCTCATTCTACAGGAGG + Intergenic
1006220855 6:32489951-32489973 CCACCATTTCACTTTAACGGTGG - Intergenic
1006611408 6:35296545-35296567 TCACCAACTCACTTTTCAGTGGG - Intergenic
1007481199 6:42151237-42151259 CCACCATCCCATTTTACAGATGG - Intergenic
1007578472 6:42940911-42940933 TCACCAGCTCCTTTAACAGGGGG - Intergenic
1008408784 6:51148727-51148749 CCACCACCTCAACTTACAGGAGG - Intergenic
1009316798 6:62229718-62229740 TCACAATCTCACTTGGCTGGGGG + Intronic
1010614902 6:78000815-78000837 TCACTATATGAGTTTACAGGAGG - Intergenic
1015668181 6:135655530-135655552 TCACATTTTCACTTTACATGTGG - Intergenic
1016104428 6:140144547-140144569 CCACCATCTCACTTTTCTGATGG + Intergenic
1017028495 6:150201126-150201148 TCATCATCTCTATTTACAGATGG - Intronic
1019350880 7:553450-553472 TCACCATCCCATTTTACAGCCGG + Intronic
1019576648 7:1740804-1740826 TCTGCAGCTCACTTTACAGCGGG - Intronic
1019713662 7:2528855-2528877 TCATCGCCTCACTTTGCAGGTGG + Intronic
1022511382 7:30936965-30936987 TCACCCACTCTCCTTACAGGTGG - Intergenic
1022520275 7:31001853-31001875 TCAGCATCTCATTTTACAAATGG + Intergenic
1024599134 7:50964201-50964223 TCATCCTCTCCCTTTACATGGGG + Intergenic
1024757082 7:52546877-52546899 TGATCATCTCAGTATACAGGAGG - Intergenic
1027952041 7:84829286-84829308 TCACTATTTAACTTTACAGATGG - Intergenic
1028803649 7:94998342-94998364 TACCCCTCTCATTTTACAGGAGG + Intronic
1028845793 7:95478524-95478546 TCAGCGACTCTCTTTACAGGTGG - Intronic
1028892077 7:95999644-95999666 TTACCATCACTCTTCACAGGCGG - Intronic
1030089153 7:105842011-105842033 TCCCCATCTCACATTCCAGCCGG - Intronic
1031029124 7:116715548-116715570 TCACGATCTGACTTTCCAGGTGG + Intronic
1036939067 8:13033749-13033771 TCACCTTCTCTCTTTTCCGGAGG - Intergenic
1037685164 8:21132432-21132454 TCATTATCTCATTTTACAGATGG + Intergenic
1039607481 8:38893810-38893832 TTTTCATCTCACTTTACAGATGG - Intergenic
1039902022 8:41759651-41759673 ACACTATATCACTTTACATGAGG + Intronic
1043319372 8:78963334-78963356 TCTCCATCTCAGTCTACAGTAGG + Intergenic
1045963257 8:107994007-107994029 TCACCTTCTAAGTTTCCAGGAGG + Intronic
1046097957 8:109582708-109582730 TCAACATATCAATTTGCAGGGGG - Intronic
1046167788 8:110461050-110461072 TTTCCATCTCACCTTACATGTGG - Intergenic
1047720684 8:127636268-127636290 TGATCATCTCATTTAACAGGTGG - Intergenic
1048133082 8:131718973-131718995 TACCCCTCTCACTTTACAGCTGG + Intergenic
1048597642 8:135883163-135883185 TCACAGTCTCTCTTTACAGAAGG - Intergenic
1049159172 8:141086468-141086490 TCAGCACCCCATTTTACAGGTGG + Intergenic
1049408552 8:142462379-142462401 TGCCCATCCCACTTTACAGATGG + Intronic
1050673107 9:8020093-8020115 TTACCATCTCACTACACAGATGG + Intergenic
1052191312 9:25666231-25666253 TCACCATTTAACTTTAAAGGAGG - Intergenic
1053462561 9:38281909-38281931 TCCCCAGCTCATTTCACAGGAGG - Intergenic
1053723413 9:40972570-40972592 TGACCATATTACTTTACATGGGG + Intergenic
1054342550 9:63879426-63879448 TGACCATATTACTTTACATGGGG - Intergenic
1055343429 9:75309283-75309305 TCACCACCTCCCTTGACTGGGGG + Intergenic
1057204562 9:93163489-93163511 TCACCATCTCCCTTGCCAGCAGG - Intergenic
1057864971 9:98673093-98673115 TCACCATCTCCGTGTACATGGGG - Intronic
1058594555 9:106601425-106601447 TCCCCATCTCAATTTAAAGAGGG - Intergenic
1061565595 9:131437543-131437565 TCACCAGCTCTCTTGACAGCGGG + Intronic
1061773772 9:132946833-132946855 TCAACTGCTCACTTTCCAGGGGG + Intronic
1062089237 9:134666244-134666266 TCATCCACTCATTTTACAGGTGG + Intronic
1203451740 Un_GL000219v1:123411-123433 TGACCATATTACTTTACATGGGG - Intergenic
1186724771 X:12345288-12345310 TCACCATCACACATTACAGGAGG - Intronic
1193216279 X:78868107-78868129 TCCTCATCTCATTTTACACGAGG + Intergenic
1193787515 X:85777719-85777741 TCACCATCTCAGATCTCAGGTGG - Intergenic
1195736279 X:108016255-108016277 TAACCCTCTCAATTTACAGGAGG - Intergenic
1195736283 X:108016292-108016314 TAACCCTCTCAATTTACAGGAGG - Intergenic
1196704487 X:118705076-118705098 TCACCTACTCAGTTTACAGTGGG + Intergenic
1197124222 X:122925160-122925182 TCACCATCTCCCTTGGCTGGGGG + Intergenic
1197793233 X:130276077-130276099 TTACCATCCCACTTTACAGATGG + Intergenic
1199081460 X:143580841-143580863 CAACCATCTCATGTTACAGGTGG + Intergenic
1200835728 Y:7729541-7729563 CCACCATCTCCCTCTCCAGGGGG + Intergenic