ID: 999484867

View in Genome Browser
Species Human (GRCh38)
Location 5:151985366-151985388
Sequence GAACATAATTCCGTTGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999484867_999484869 -8 Left 999484867 5:151985366-151985388 CCTAGGTCAACGGAATTATGTTC No data
Right 999484869 5:151985381-151985403 TTATGTTCCTAGGAGTATTATGG No data
999484867_999484874 30 Left 999484867 5:151985366-151985388 CCTAGGTCAACGGAATTATGTTC No data
Right 999484874 5:151985419-151985441 CATGCAGCCTTTCAGGGAAATGG No data
999484867_999484872 23 Left 999484867 5:151985366-151985388 CCTAGGTCAACGGAATTATGTTC No data
Right 999484872 5:151985412-151985434 GCTGAGTCATGCAGCCTTTCAGG No data
999484867_999484873 24 Left 999484867 5:151985366-151985388 CCTAGGTCAACGGAATTATGTTC No data
Right 999484873 5:151985413-151985435 CTGAGTCATGCAGCCTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999484867 Original CRISPR GAACATAATTCCGTTGACCT AGG (reversed) Intergenic
No off target data available for this crispr