ID: 999484869

View in Genome Browser
Species Human (GRCh38)
Location 5:151985381-151985403
Sequence TTATGTTCCTAGGAGTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999484867_999484869 -8 Left 999484867 5:151985366-151985388 CCTAGGTCAACGGAATTATGTTC No data
Right 999484869 5:151985381-151985403 TTATGTTCCTAGGAGTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999484869 Original CRISPR TTATGTTCCTAGGAGTATTA TGG Intergenic
No off target data available for this crispr