ID: 999486200

View in Genome Browser
Species Human (GRCh38)
Location 5:151998797-151998819
Sequence AAGTATAACCCCAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999486200_999486201 -4 Left 999486200 5:151998797-151998819 CCTTGCTCTTTGGGGTTATACTT No data
Right 999486201 5:151998816-151998838 ACTTTGACTTCTTTTTCTTTTGG No data
999486200_999486203 -2 Left 999486200 5:151998797-151998819 CCTTGCTCTTTGGGGTTATACTT No data
Right 999486203 5:151998818-151998840 TTTGACTTCTTTTTCTTTTGGGG No data
999486200_999486202 -3 Left 999486200 5:151998797-151998819 CCTTGCTCTTTGGGGTTATACTT No data
Right 999486202 5:151998817-151998839 CTTTGACTTCTTTTTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999486200 Original CRISPR AAGTATAACCCCAAAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr