ID: 999486203

View in Genome Browser
Species Human (GRCh38)
Location 5:151998818-151998840
Sequence TTTGACTTCTTTTTCTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999486196_999486203 28 Left 999486196 5:151998767-151998789 CCTCTATTTCTGAGATCTTCTTT No data
Right 999486203 5:151998818-151998840 TTTGACTTCTTTTTCTTTTGGGG No data
999486200_999486203 -2 Left 999486200 5:151998797-151998819 CCTTGCTCTTTGGGGTTATACTT No data
Right 999486203 5:151998818-151998840 TTTGACTTCTTTTTCTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999486203 Original CRISPR TTTGACTTCTTTTTCTTTTG GGG Intergenic
No off target data available for this crispr