ID: 999489820

View in Genome Browser
Species Human (GRCh38)
Location 5:152039057-152039079
Sequence GCAGCCAGGAAGTTTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999489820_999489826 29 Left 999489820 5:152039057-152039079 CCCAGTTCAAACTTCCTGGCTGC No data
Right 999489826 5:152039109-152039131 TACTCAAGCCTCAGCAATGGTGG 0: 1046
1: 1343
2: 949
3: 788
4: 2278
999489820_999489824 26 Left 999489820 5:152039057-152039079 CCCAGTTCAAACTTCCTGGCTGC No data
Right 999489824 5:152039106-152039128 ACCTACTCAAGCCTCAGCAATGG 0: 1335
1: 1630
2: 1504
3: 1312
4: 2555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999489820 Original CRISPR GCAGCCAGGAAGTTTGAACT GGG (reversed) Intergenic
No off target data available for this crispr