ID: 999490383

View in Genome Browser
Species Human (GRCh38)
Location 5:152044436-152044458
Sequence AGGCACTGAGCACTATTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999490377_999490383 -2 Left 999490377 5:152044415-152044437 CCCCCAGGATTTTCCATGAGGAG No data
Right 999490383 5:152044436-152044458 AGGCACTGAGCACTATTCCAAGG No data
999490381_999490383 -5 Left 999490381 5:152044418-152044440 CCAGGATTTTCCATGAGGAGGCA No data
Right 999490383 5:152044436-152044458 AGGCACTGAGCACTATTCCAAGG No data
999490378_999490383 -3 Left 999490378 5:152044416-152044438 CCCCAGGATTTTCCATGAGGAGG No data
Right 999490383 5:152044436-152044458 AGGCACTGAGCACTATTCCAAGG No data
999490380_999490383 -4 Left 999490380 5:152044417-152044439 CCCAGGATTTTCCATGAGGAGGC No data
Right 999490383 5:152044436-152044458 AGGCACTGAGCACTATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999490383 Original CRISPR AGGCACTGAGCACTATTCCA AGG Intergenic
No off target data available for this crispr