ID: 999491805

View in Genome Browser
Species Human (GRCh38)
Location 5:152058482-152058504
Sequence CAGGCTGAAGATACTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999491800_999491805 -10 Left 999491800 5:152058469-152058491 CCCTGGCCCCTTTCAGGCTGAAG No data
Right 999491805 5:152058482-152058504 CAGGCTGAAGATACTGTAGCTGG No data
999491797_999491805 10 Left 999491797 5:152058449-152058471 CCTTGTAGCAGTATGTGCTGCCC No data
Right 999491805 5:152058482-152058504 CAGGCTGAAGATACTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999491805 Original CRISPR CAGGCTGAAGATACTGTAGC TGG Intergenic
No off target data available for this crispr