ID: 999495949

View in Genome Browser
Species Human (GRCh38)
Location 5:152097102-152097124
Sequence TGACCCTGCTTTCTCTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999495949_999495950 8 Left 999495949 5:152097102-152097124 CCTAAGCAGAGAAAGCAGGGTCA No data
Right 999495950 5:152097133-152097155 ATAGAATCACCAGATTCACTTGG No data
999495949_999495951 13 Left 999495949 5:152097102-152097124 CCTAAGCAGAGAAAGCAGGGTCA No data
Right 999495951 5:152097138-152097160 ATCACCAGATTCACTTGGCTTGG No data
999495949_999495953 15 Left 999495949 5:152097102-152097124 CCTAAGCAGAGAAAGCAGGGTCA No data
Right 999495953 5:152097140-152097162 CACCAGATTCACTTGGCTTGGGG No data
999495949_999495955 20 Left 999495949 5:152097102-152097124 CCTAAGCAGAGAAAGCAGGGTCA No data
Right 999495955 5:152097145-152097167 GATTCACTTGGCTTGGGGAAAGG No data
999495949_999495952 14 Left 999495949 5:152097102-152097124 CCTAAGCAGAGAAAGCAGGGTCA No data
Right 999495952 5:152097139-152097161 TCACCAGATTCACTTGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999495949 Original CRISPR TGACCCTGCTTTCTCTGCTT AGG (reversed) Intergenic
No off target data available for this crispr