ID: 999495953

View in Genome Browser
Species Human (GRCh38)
Location 5:152097140-152097162
Sequence CACCAGATTCACTTGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999495949_999495953 15 Left 999495949 5:152097102-152097124 CCTAAGCAGAGAAAGCAGGGTCA No data
Right 999495953 5:152097140-152097162 CACCAGATTCACTTGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999495953 Original CRISPR CACCAGATTCACTTGGCTTG GGG Intergenic
No off target data available for this crispr