ID: 999496925

View in Genome Browser
Species Human (GRCh38)
Location 5:152108190-152108212
Sequence TAGATTGTAGGAAGGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999496921_999496925 6 Left 999496921 5:152108161-152108183 CCTTGTCAGACTGACATGTGTGA No data
Right 999496925 5:152108190-152108212 TAGATTGTAGGAAGGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999496925 Original CRISPR TAGATTGTAGGAAGGAAGGC TGG Intergenic
No off target data available for this crispr