ID: 999498038

View in Genome Browser
Species Human (GRCh38)
Location 5:152119442-152119464
Sequence CTGTGTCAGGAGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999498028_999498038 20 Left 999498028 5:152119399-152119421 CCCACTGCATTCCAGAGGTGCAG No data
Right 999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG No data
999498029_999498038 19 Left 999498029 5:152119400-152119422 CCACTGCATTCCAGAGGTGCAGA No data
Right 999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG No data
999498033_999498038 -6 Left 999498033 5:152119425-152119447 CCAATCTGAGGCAGGTGCTGTGT No data
Right 999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG No data
999498030_999498038 9 Left 999498030 5:152119410-152119432 CCAGAGGTGCAGACGCCAATCTG No data
Right 999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG No data
999498026_999498038 26 Left 999498026 5:152119393-152119415 CCAATGCCCACTGCATTCCAGAG No data
Right 999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG No data
999498025_999498038 30 Left 999498025 5:152119389-152119411 CCTGCCAATGCCCACTGCATTCC No data
Right 999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999498038 Original CRISPR CTGTGTCAGGAGCAGGTGGA GGG Intergenic
No off target data available for this crispr