ID: 999499226

View in Genome Browser
Species Human (GRCh38)
Location 5:152130171-152130193
Sequence CTGTGGTTATTGTGGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999499226_999499233 3 Left 999499226 5:152130171-152130193 CCCTCCCACCACAATAACCACAG No data
Right 999499233 5:152130197-152130219 AATTAATCTAATATTCAAATGGG No data
999499226_999499232 2 Left 999499226 5:152130171-152130193 CCCTCCCACCACAATAACCACAG No data
Right 999499232 5:152130196-152130218 CAATTAATCTAATATTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999499226 Original CRISPR CTGTGGTTATTGTGGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr