ID: 999499609

View in Genome Browser
Species Human (GRCh38)
Location 5:152133518-152133540
Sequence CAGGTTCAAGAATCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999499606_999499609 -5 Left 999499606 5:152133500-152133522 CCAAGATCAAGGTCTTGGCAGGT No data
Right 999499609 5:152133518-152133540 CAGGTTCAAGAATCTGAGGAGGG No data
999499603_999499609 5 Left 999499603 5:152133490-152133512 CCTAGAAGTTCCAAGATCAAGGT No data
Right 999499609 5:152133518-152133540 CAGGTTCAAGAATCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999499609 Original CRISPR CAGGTTCAAGAATCTGAGGA GGG Intergenic
No off target data available for this crispr