ID: 999499609 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:152133518-152133540 |
Sequence | CAGGTTCAAGAATCTGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
999499606_999499609 | -5 | Left | 999499606 | 5:152133500-152133522 | CCAAGATCAAGGTCTTGGCAGGT | No data | ||
Right | 999499609 | 5:152133518-152133540 | CAGGTTCAAGAATCTGAGGAGGG | No data | ||||
999499603_999499609 | 5 | Left | 999499603 | 5:152133490-152133512 | CCTAGAAGTTCCAAGATCAAGGT | No data | ||
Right | 999499609 | 5:152133518-152133540 | CAGGTTCAAGAATCTGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
999499609 | Original CRISPR | CAGGTTCAAGAATCTGAGGA GGG | Intergenic | ||
No off target data available for this crispr |