ID: 999499881

View in Genome Browser
Species Human (GRCh38)
Location 5:152136234-152136256
Sequence CTGTGTTTGGGGAATGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999499881_999499889 27 Left 999499881 5:152136234-152136256 CCACCCACATTCCCCAAACACAG No data
Right 999499889 5:152136284-152136306 CTCATGTTGTTTCTTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999499881 Original CRISPR CTGTGTTTGGGGAATGTGGG TGG (reversed) Intergenic
No off target data available for this crispr