ID: 999501368

View in Genome Browser
Species Human (GRCh38)
Location 5:152149811-152149833
Sequence CCTTTGTAAGCCCTGCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999501365_999501368 -9 Left 999501365 5:152149797-152149819 CCCTCACAACTGAACCTTTGTAA No data
Right 999501368 5:152149811-152149833 CCTTTGTAAGCCCTGCCTTCAGG No data
999501364_999501368 8 Left 999501364 5:152149780-152149802 CCTCAGTAGAAGGTTATCCCTCA No data
Right 999501368 5:152149811-152149833 CCTTTGTAAGCCCTGCCTTCAGG No data
999501366_999501368 -10 Left 999501366 5:152149798-152149820 CCTCACAACTGAACCTTTGTAAG No data
Right 999501368 5:152149811-152149833 CCTTTGTAAGCCCTGCCTTCAGG No data
999501363_999501368 9 Left 999501363 5:152149779-152149801 CCCTCAGTAGAAGGTTATCCCTC No data
Right 999501368 5:152149811-152149833 CCTTTGTAAGCCCTGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999501368 Original CRISPR CCTTTGTAAGCCCTGCCTTC AGG Intergenic
No off target data available for this crispr