ID: 999501434

View in Genome Browser
Species Human (GRCh38)
Location 5:152150480-152150502
Sequence CTCAAATGCTTACAGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999501434_999501437 -9 Left 999501434 5:152150480-152150502 CCTGGACCCTGTAAGCATTTGAG No data
Right 999501437 5:152150494-152150516 GCATTTGAGTTTGTGACACCTGG No data
999501434_999501438 -3 Left 999501434 5:152150480-152150502 CCTGGACCCTGTAAGCATTTGAG No data
Right 999501438 5:152150500-152150522 GAGTTTGTGACACCTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999501434 Original CRISPR CTCAAATGCTTACAGGGTCC AGG (reversed) Intergenic
No off target data available for this crispr