ID: 999507526

View in Genome Browser
Species Human (GRCh38)
Location 5:152213615-152213637
Sequence GGGAGAAATAGGACGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999507520_999507526 15 Left 999507520 5:152213577-152213599 CCATGGTGCTGATTGAGATCACA No data
Right 999507526 5:152213615-152213637 GGGAGAAATAGGACGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999507526 Original CRISPR GGGAGAAATAGGACGACTGA GGG Intergenic
No off target data available for this crispr