ID: 999512774

View in Genome Browser
Species Human (GRCh38)
Location 5:152270110-152270132
Sequence CAGGAACTTGCCTAGTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512774 Original CRISPR CAGGAACTTGCCTAGTAGTG AGG (reversed) Intergenic