ID: 999512775

View in Genome Browser
Species Human (GRCh38)
Location 5:152270129-152270151
Sequence CAGAATCAAGAGATGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 721}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512775 Original CRISPR CAGAATCAAGAGATGGAGAC AGG (reversed) Intergenic
900129195 1:1080449-1080471 CAGAATTGAGAGATGGGGCCTGG + Intergenic
901309476 1:8257917-8257939 GAGAATCAGGAAATGCAGACGGG + Intergenic
902069452 1:13722043-13722065 CAGAATCAGGACATGGTTACCGG - Intronic
902905129 1:19550918-19550940 CAGGATTAAGAGATAAAGACAGG + Intergenic
903279487 1:22242391-22242413 GAGATTTGAGAGATGGAGACAGG + Intergenic
903596579 1:24500099-24500121 TAGAGTCAAGAAATGGAGGCCGG + Intergenic
903847949 1:26289651-26289673 CAGACTCAAGTGAAGAAGACGGG + Intronic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
905096975 1:35480953-35480975 CTGAGCCTAGAGATGGAGACAGG - Intronic
905950353 1:41945654-41945676 CAGAATCAGAACATGGAGATTGG + Intronic
905960622 1:42039650-42039672 GAGAATAAAGAAATGGATACTGG - Intergenic
906507334 1:46389961-46389983 CAGAATCAGAACATGGAGATTGG - Intergenic
907602565 1:55785624-55785646 CAGAATCAGAACATGGAGATTGG - Intergenic
907813656 1:57897328-57897350 CAGGAACAAGAGAACGAGACAGG + Intronic
907866294 1:58402497-58402519 AAGAAACAAGAGATGGAGGGAGG + Intronic
907991283 1:59585401-59585423 CAGAAACAAGAAATGGGGAAAGG + Intronic
908100065 1:60781698-60781720 CAAAAACAAGAAATGGAGAAAGG + Intergenic
908735009 1:67267346-67267368 CAGAAGCAAGAGAGAGAGAAGGG - Intergenic
908864783 1:68535093-68535115 CAGAAACAAGTAATGGAGAAAGG + Intergenic
908879386 1:68713514-68713536 CAAAAACAAGAAATGGAGAAAGG + Intergenic
909080125 1:71100547-71100569 TAGCATCAAGTGAAGGAGACTGG + Intergenic
909512857 1:76474596-76474618 CAGAAGCAAAGGATGGAGTCAGG + Intronic
909940138 1:81602086-81602108 CAGAATCTATATATGGAGAGAGG - Intronic
909949552 1:81703700-81703722 GAGAATGAAGAAATGGAAACTGG + Intronic
910335162 1:86120023-86120045 CAAAAACAAGAAATGGAGAAAGG + Intronic
910571827 1:88714041-88714063 CAGAAACAAGAAATGGAGAAAGG - Intronic
910590998 1:88928014-88928036 CAGAATCAGAACATGGAGATTGG + Intergenic
910880521 1:91918791-91918813 CAAAGTCAAGAGATTGAGGCCGG - Intergenic
911195157 1:94987138-94987160 CAGAGCCGAGAGATGAAGACAGG + Intronic
911677704 1:100678185-100678207 CAGAAACAAGAAATGGGGAAAGG - Intergenic
911887318 1:103320439-103320461 CTGAATCAAGAATTGGAGACTGG - Intergenic
912001141 1:104836323-104836345 CAAAAACAAGAAATGGAGAAAGG + Intergenic
912114667 1:106390567-106390589 CAAAATCCAGTGAAGGAGACAGG + Intergenic
913100458 1:115559348-115559370 GAGAAGAAAGAGATGGAGATTGG - Intergenic
913310246 1:117482999-117483021 CAAAAACAAGAAATGGAGAAAGG - Intronic
914241723 1:145857334-145857356 CAGAGTCCAGGGATGGAGGCGGG - Intronic
914412366 1:147443163-147443185 CAAAAACAAGAAATGGAGAAAGG + Intergenic
914834311 1:151194861-151194883 TAGAATGAAGTGATGGGGACTGG - Intronic
915092739 1:153437947-153437969 ACCATTCAAGAGATGGAGACTGG - Intronic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915571902 1:156749460-156749482 CACAATCAAGAGCCAGAGACAGG + Intronic
915772935 1:158448255-158448277 CAGAATCTAGAGTGAGAGACAGG - Intergenic
916624860 1:166544429-166544451 CACAATAAAGAGCTGGGGACTGG - Intergenic
917111359 1:171551721-171551743 CAAAAACAAGAAATGGAGAAAGG - Intronic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
919065102 1:192684212-192684234 CAAAACCAAGAAATGGAGAAAGG - Intergenic
919830243 1:201535835-201535857 CAGAACCAAGGCATGGAGTCAGG + Intergenic
920425246 1:205869838-205869860 CAGAATCAGAACATGGAGATTGG - Intergenic
920521439 1:206630266-206630288 TAGAAACAAGAAATGGAGATAGG + Intergenic
920633936 1:207680400-207680422 CAAACTCAAGATATTGAGACAGG - Intronic
921717085 1:218428595-218428617 CAAAAACAAGAAATGGAGAAAGG - Intronic
922684724 1:227630313-227630335 CAGAATCAGAACATGGAGATTGG - Intronic
924147151 1:241088233-241088255 TAGAATCAAGAGAGTGAGAGAGG + Intronic
924186888 1:241502174-241502196 CAGCAGCATGAGAAGGAGACAGG + Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924631429 1:245744413-245744435 CAGAATCAAGGGATGGGTACAGG - Intergenic
1063295137 10:4797605-4797627 CAGAATCCAGGAATAGAGACAGG - Intronic
1063305620 10:4897056-4897078 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1063340325 10:5257024-5257046 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1063417027 10:5881985-5882007 CGGGGTCAAGAGATCGAGACCGG - Intronic
1064303205 10:14141093-14141115 GAGAAGCAGGAGATGGAGAATGG + Intronic
1064522474 10:16217526-16217548 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1064921753 10:20526972-20526994 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1065157936 10:22889829-22889851 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1065199647 10:23300743-23300765 CAGAATCAGAACATGGAGATTGG - Intronic
1065494850 10:26317585-26317607 AAAAATCAAGAGACAGAGACTGG - Intergenic
1065595224 10:27304106-27304128 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1067330600 10:45313469-45313491 CTGAATCAAAAGATATAGACTGG + Intronic
1067472844 10:46548841-46548863 CAGGATGAAGAGGTGAAGACAGG + Intergenic
1068111485 10:52685630-52685652 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1068210426 10:53913172-53913194 CAGAAACAAGAAATGGGGAAAGG + Intronic
1069795299 10:71048042-71048064 GAGAATCCAGAGATGGACCCAGG + Intergenic
1070153155 10:73817716-73817738 CAGACTGCAGAGAGGGAGACGGG - Intronic
1070349745 10:75580800-75580822 CAAAATCAAGAAATGGGGAAAGG + Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070586861 10:77772939-77772961 TACCATCAAGACATGGAGACCGG + Intergenic
1070687876 10:78503104-78503126 CAGAAACAAGAAATTGAAACAGG + Intergenic
1071366810 10:84908305-84908327 CAGCTTCAAGAGATGAAGAAAGG + Intergenic
1071479027 10:86049168-86049190 CAGCATCATGTGATGGTGACAGG - Intronic
1071900359 10:90114335-90114357 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1072053812 10:91733056-91733078 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1072357900 10:94629996-94630018 CAAAAACAAGCAATGGAGACAGG - Intergenic
1072378111 10:94838195-94838217 CAGAATCAGAACATGGAGATTGG - Intronic
1072393711 10:95016534-95016556 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1072410680 10:95199232-95199254 CAAAAACAAGAAATGGAGAAAGG + Intronic
1072471959 10:95721281-95721303 CAGAATCAGAACATGGAGATTGG - Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072833247 10:98682210-98682232 CAGAAACAAGAGACAGAGAAGGG - Intronic
1073277488 10:102325044-102325066 CAGAATCCAGAGGTAAAGACTGG - Intronic
1073373665 10:103013793-103013815 CAGAAACAAGTTATGGTGACTGG + Intronic
1074796903 10:116955844-116955866 CAGAAGCTAGAGTTGGAGACTGG - Intronic
1075990438 10:126833838-126833860 CAGAAGCAAGAGGTTGCGACGGG - Intergenic
1076078173 10:127554262-127554284 CAGAAGCCAGAGATGCAGACAGG + Intergenic
1076188243 10:128465162-128465184 CTGAATCAAGAGATAGAAGCCGG - Intergenic
1076748023 10:132524128-132524150 GAGAAGCAAGAGAAAGAGACGGG - Intergenic
1077450009 11:2635441-2635463 CAGAAACAAGAAATGGGGAAAGG - Intronic
1077830817 11:5868104-5868126 CAGAAACAAGAAATGGGGAAAGG - Intronic
1078478045 11:11650928-11650950 CAGACTCAAGAGATAGAGAAAGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078866434 11:15302357-15302379 CAGGATCCAGAGATGGGGATGGG - Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079601355 11:22316003-22316025 CAGAATCAGAACATGGAGATTGG - Intergenic
1079933777 11:26594214-26594236 CAAAATCAGAAGATGGAGATTGG - Intronic
1080080956 11:28217818-28217840 CAAAAACAAGAAATGGAGAAAGG - Intronic
1080082212 11:28235065-28235087 CAAAAACAAGAAATGGAGAAAGG - Intronic
1080235412 11:30062897-30062919 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1080365158 11:31565633-31565655 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080810462 11:35699044-35699066 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080811375 11:35707644-35707666 CAAAAACAAGAGATGGGGAAAGG + Intronic
1080915312 11:36651812-36651834 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080917909 11:36678798-36678820 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1080922750 11:36725077-36725099 TAGAAAGAAGAGATGGAAACTGG + Intergenic
1081070536 11:38604586-38604608 CAGAATCAGAACATGGAGATTGG + Intergenic
1081354973 11:42101527-42101549 GATAATCAAGTGATGGAGAAAGG + Intergenic
1081499753 11:43654655-43654677 CAAAATCAAGAAATGGGGAAAGG - Intronic
1081505703 11:43714383-43714405 CAAAATCAAGAAATGGGGAAAGG - Intronic
1081768693 11:45632454-45632476 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1081958400 11:47114107-47114129 CAAAATCAAGAAATGGGGAAAGG - Intronic
1082648709 11:55760184-55760206 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1082723771 11:56710668-56710690 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1082885205 11:58074865-58074887 CAAAAACAAGAAATGGAGAAAGG - Intronic
1082943667 11:58735349-58735371 AGGAAGCAAGAGATAGAGACGGG - Intergenic
1083124691 11:60552529-60552551 CCCAATTAAGAGATGCAGACTGG + Intergenic
1085343367 11:75748596-75748618 CAAGGTCAAGAGATGGAGACCGG + Intergenic
1085355873 11:75836404-75836426 CAAAATCAAGATTTGGACACAGG + Intronic
1085827487 11:79863689-79863711 CAGGAGCAAGAGATAGAGAGGGG - Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1087083111 11:94190911-94190933 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1087133861 11:94694732-94694754 CAGAAACAGGTGATGGAAACTGG + Intergenic
1087398534 11:97634228-97634250 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1087504402 11:99001317-99001339 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1087623211 11:100565966-100565988 CAGAATGAAGAGATAGAAAAAGG - Intergenic
1088004221 11:104921450-104921472 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1088078284 11:105878622-105878644 AAGAATCTAGAGAGGGAGTCTGG + Intronic
1088211500 11:107461770-107461792 CAAAATCAAGAAATGGAGAAAGG - Intergenic
1088228673 11:107650229-107650251 TTGAATCCAGAGATGGATACTGG - Intronic
1088412240 11:109547352-109547374 CATAAGAAAGAGAGGGAGACAGG - Intergenic
1088945533 11:114508624-114508646 CAGAAACAAGTAATGGAGAAAGG + Intergenic
1089582819 11:119492134-119492156 CAGAATCAATTGATGGAGAGAGG + Intergenic
1089743144 11:120598914-120598936 CAGACTCAAGGGATGGATAATGG + Intronic
1090023641 11:123149463-123149485 CAGAACCCAGAGATGGTGACTGG - Intronic
1090103352 11:123825403-123825425 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1090279259 11:125442202-125442224 CAGAAGCAAGAAATGGGGAGTGG - Intergenic
1090315464 11:125783422-125783444 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1090933147 11:131317396-131317418 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1092076086 12:5674721-5674743 CAGAATCAAGTGACAGAGACAGG - Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092294041 12:7184039-7184061 CAGAATCAGAACATGGAGATTGG + Intergenic
1092469490 12:8765301-8765323 CAGAATCAGAACATGGAGATTGG - Intronic
1092565609 12:9662207-9662229 CCGAATTAAGAGGTGGACACAGG + Intergenic
1092628934 12:10358232-10358254 AAGAATCTAGAGAGGCAGACTGG + Intergenic
1093256527 12:16874662-16874684 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1093350365 12:18092453-18092475 CAAAAACAAGAAATGGAGAAAGG - Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093747829 12:22762993-22763015 CAGCATCAACAGATTAAGACAGG + Intergenic
1093904758 12:24677418-24677440 GAGATTCTAGAGATGGAGATGGG - Intergenic
1093905374 12:24685131-24685153 CAAAAACAAGCGATGGAGAAAGG - Intergenic
1094240262 12:28213995-28214017 AAGAATCAAGGGGTGGAAACAGG + Intronic
1095138935 12:38639323-38639345 CAGAATCAGAACATGGAGATTGG + Intergenic
1095283889 12:40387103-40387125 CAGAATCAGAACATGGAGATTGG + Intergenic
1095442822 12:42254979-42255001 AGGAATCAAGAGATGGAAATGGG - Intronic
1095734601 12:45542752-45542774 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1096352108 12:50909103-50909125 CAGAATCAGAACATGGAGATTGG - Intergenic
1096402703 12:51320439-51320461 CATAAGCAAGGCATGGAGACTGG - Intronic
1096574168 12:52542376-52542398 CAAAACCAAGTGCTGGAGACTGG - Intergenic
1096924503 12:55128457-55128479 CAGAATCAAGATTTGAAGCCAGG - Intergenic
1096950533 12:55464186-55464208 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1097149698 12:56967577-56967599 CAGAATCAGAACATGGAGATTGG - Intergenic
1097321192 12:58228199-58228221 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1097377302 12:58856170-58856192 CAGAATCAGAACATGGAGATTGG - Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097453446 12:59765592-59765614 CAAAATCAAGAAATGGGGAAAGG - Intronic
1097788027 12:63782661-63782683 CAGAAGCCAGAAATGGAGATGGG - Intronic
1098054709 12:66492702-66492724 CAGAATCAAGGAATTTAGACTGG + Intronic
1098055906 12:66504965-66504987 CAAAATCAAGACAAAGAGACAGG - Intronic
1098150906 12:67545352-67545374 AAGAGACAGGAGATGGAGACAGG - Intergenic
1099489695 12:83273230-83273252 CAGAAACAAGCAATGGAGAAAGG - Intergenic
1099560713 12:84171152-84171174 CAGATTCAATATATGGAGAAAGG + Intergenic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099696020 12:86020467-86020489 CAAAAACAAGAGATGGGGAAAGG + Intronic
1099767454 12:87006282-87006304 CAGAGTAAAGGGATGGAGAAAGG - Intergenic
1101802012 12:108030693-108030715 TAGAAGCAAGAGATGGAGATGGG + Intergenic
1102081447 12:110101537-110101559 CAGAATCTGGAGTTGGGGACAGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1103803012 12:123551710-123551732 CAGAATCAGAACATGGAGATTGG + Intergenic
1104253278 12:127116982-127117004 TATAATCAAAAGAAGGAGACGGG - Intergenic
1105875551 13:24549681-24549703 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1105993053 13:25641982-25642004 CAGAAACAAGAAATGGGGAAAGG + Intronic
1106094546 13:26631431-26631453 CAAAAACAAGAAATGGAGAAAGG - Intronic
1106347843 13:28896783-28896805 CAAAAACAAGAAATGGAGAAAGG + Intronic
1106617693 13:31345239-31345261 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1107167427 13:37298984-37299006 CAGAAGCAAGAGAAAGAGATGGG + Intergenic
1107578035 13:41748740-41748762 CAGAAACAAGAAATGGGGAAAGG + Intronic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108154201 13:47568765-47568787 CAAAAACAAGCGATGGAGAAAGG + Intergenic
1108214313 13:48169086-48169108 AAGAATGGAGACATGGAGACTGG + Intergenic
1108234045 13:48382954-48382976 CAAAAACAAGAAATGGAGAAAGG - Intronic
1108364207 13:49693689-49693711 CAGGGTCAAGACATGAAGACAGG - Intergenic
1108876643 13:55057196-55057218 CAGAATCAGAACATGGAGATTGG + Intergenic
1108896574 13:55335637-55335659 CAGAAGCAAGAGAAAGAGAGTGG - Intergenic
1109555272 13:63966042-63966064 CAAAACCAAGAGAGGGAGAGAGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1109606762 13:64706759-64706781 CAGAATCAGAATATGGAGATTGG - Intergenic
1109816642 13:67593200-67593222 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1109888507 13:68575450-68575472 CAGAAACAAAAGATGGAGAAGGG - Intergenic
1109910427 13:68904362-68904384 CAGAAGCAAGAGAGAGAGAGGGG - Intergenic
1109931715 13:69225045-69225067 CAGAATCAGAACATGGAGATTGG + Intergenic
1110046287 13:70836260-70836282 AAGAAAAAAGAGATGGAGAGAGG - Intergenic
1110504123 13:76264840-76264862 CAGAAACAAGCAATGGAGAAAGG + Intergenic
1110699563 13:78530921-78530943 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1110890722 13:80694479-80694501 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111537985 13:89629004-89629026 AAGACTCAAGAGGTGGAAACAGG - Intergenic
1111611329 13:90611786-90611808 GAGGAACAAGAGCTGGAGACAGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1113397200 13:109959242-109959264 CAAAAACAAGTGATGGTGACAGG - Intergenic
1113397398 13:109961340-109961362 CAGCATCAGGAGATGGACAGAGG - Intergenic
1113474382 13:110569881-110569903 CAAAATCAAGAGATGTAAAGAGG + Intergenic
1113789393 13:113019540-113019562 CAAAGTCATGAGACGGAGACAGG + Intronic
1113824890 13:113244543-113244565 CATAATCAAGAGGTGTAAACAGG + Intronic
1114044131 14:18706993-18707015 CAAAATCAAGAAATGGGGAAAGG + Intergenic
1115005181 14:28473982-28474004 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1115386597 14:32805116-32805138 CAGGATTAAGAGATTAAGACAGG + Intronic
1116136324 14:40928514-40928536 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1116488106 14:45475801-45475823 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1116717546 14:48446919-48446941 CAAAAACAAGAAATGGGGACAGG + Intergenic
1116722615 14:48519184-48519206 CAGAAACAAGAGAAGGGTACTGG + Intergenic
1117497518 14:56320128-56320150 CAGAAGCAAGAGAGGGAGCGGGG - Intergenic
1117822783 14:59668334-59668356 CAAAAACAAGAAATGGGGACAGG + Intronic
1117877597 14:60271296-60271318 AAGAATCTTGAGATGGAGAGAGG - Intronic
1118179134 14:63473652-63473674 CAGACTCAAGAGGCTGAGACAGG + Intronic
1118268388 14:64317466-64317488 CAGAAGCAAGATAGAGAGACAGG + Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118700687 14:68430007-68430029 CAAAATCAAGAAATGGGGAAAGG - Intronic
1119006669 14:70937393-70937415 CAGAAACAAGAAATGGGGAAAGG - Intronic
1119240323 14:73053955-73053977 CAGAATCTAGAGATCAAGGCTGG - Intergenic
1120137722 14:80889509-80889531 CAAAAACAAGAAATGGAGAAAGG + Intronic
1120654717 14:87176227-87176249 TAGAATCTCGCGATGGAGACAGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121695652 14:95909804-95909826 CCAAATCAAGAGATGGTGACAGG + Intergenic
1121934396 14:98003955-98003977 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1123428794 15:20196175-20196197 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1123586074 15:21761794-21761816 CAGAATCAAGTGACAGAGACAGG + Intergenic
1123622716 15:22204384-22204406 CAGAATCAAGTGACAGAGACAGG + Intergenic
1124135317 15:27030136-27030158 CACAATTTAGAGATGCAGACAGG + Intronic
1124970605 15:34486388-34486410 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1126059901 15:44770550-44770572 CAGGATTAAGAGATTAAGACAGG - Intergenic
1126666529 15:51080539-51080561 AAGAAACAGGAGATGGACACAGG - Intronic
1127074332 15:55311017-55311039 CAGAATCAGGATATGGAGATTGG - Intronic
1127527510 15:59808217-59808239 CAAAAGCAAGAAATGGAGAAAGG + Intergenic
1128440302 15:67701129-67701151 TAGAATGAAGAAATGGAGAGAGG + Intronic
1128820191 15:70645235-70645257 CAAAATCAAGAAATTGACACTGG + Intergenic
1129044505 15:72721890-72721912 CAGTATCAAGAGATGCAGGTTGG + Intronic
1129148409 15:73670755-73670777 CAGATTCAATAGATGAAGGCTGG - Intergenic
1129231356 15:74198908-74198930 CAGAATCATGTGGTGGAGAAAGG + Intronic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1129585165 15:76855157-76855179 CAAAAACAAGATATGGAGAAAGG + Intronic
1129911472 15:79230948-79230970 CAGAAGCAAGAGAGAGAGAGAGG + Intergenic
1130325661 15:82877823-82877845 CACTATCAAGAGATGGGGGCAGG + Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1131209055 15:90477678-90477700 CAGATTCAAGAGATTGTGACAGG + Exonic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1132987621 16:2776309-2776331 CAGATTCTAGAGCTGGAAACTGG - Intronic
1133579709 16:7131433-7131455 CAGAAGCAAGAGATGTAAAGTGG - Intronic
1133786415 16:8977164-8977186 CAGAAGCAAGAAATGGGGAAAGG - Intergenic
1134195218 16:12154550-12154572 GAGGATGAAGAGTTGGAGACGGG - Intronic
1134239860 16:12497600-12497622 CAAATACAAGAGAAGGAGACTGG - Intronic
1134821801 16:17252985-17253007 CTAAATGAGGAGATGGAGACAGG - Intronic
1134914423 16:18058067-18058089 CAGGAGCAAGAGAGAGAGACTGG + Intergenic
1135224701 16:20645743-20645765 CAGAATCAGAACATGGAGATTGG + Intronic
1135676695 16:24421185-24421207 CAGAAGCAAGAGAGCGAGGCTGG - Intergenic
1136855527 16:33653568-33653590 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1136908073 16:34120385-34120407 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137663534 16:50232313-50232335 CAGAATCAACTGTTGAAGACTGG - Intronic
1137700413 16:50493921-50493943 CAGAAGCCAGGGATGGAGCCTGG + Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1141017125 16:80461126-80461148 CAGAATCCAGAGAGAGAGAGAGG + Intergenic
1141385638 16:83620174-83620196 CGAGGTCAAGAGATGGAGACCGG + Intronic
1141610007 16:85175930-85175952 CAGACTCAAGAGCTGGACTCAGG - Intronic
1142122942 16:88396278-88396300 CAGAGCCAGGAGATGAAGACAGG - Intergenic
1203117113 16_KI270728v1_random:1502049-1502071 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1143069157 17:4275993-4276015 CAGAAGGAAGAGACAGAGACTGG - Intronic
1143152997 17:4818651-4818673 CAGAATCAGGAGGGGGACACGGG - Intronic
1143680728 17:8474033-8474055 CAGGAACAAGAGTTGGAGCCAGG + Intronic
1145840530 17:27990433-27990455 CAGGAGCAAGAGAGGGAGAGTGG - Intergenic
1146496184 17:33324572-33324594 CAGAATCAAGACACCAAGACTGG + Intronic
1147279583 17:39347951-39347973 CAAAATCAAGAAATGGAGAAAGG - Intronic
1147793859 17:43029009-43029031 CAGAACCAGGATATGGGGACTGG - Exonic
1148022867 17:44565200-44565222 CTGAATCAGGAGATAGAGAGAGG + Intergenic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149274126 17:55015279-55015301 CAGAATCAGAACATGGAGATTGG - Intronic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1151345125 17:73496735-73496757 AGGAATCAAGAATTGGAGACTGG - Intronic
1151420634 17:73994860-73994882 AAAAATCAAGAGAAAGAGACTGG + Intergenic
1152214243 17:79023369-79023391 CAGAGTCTAGGGATGGAGACTGG + Intronic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1153401506 18:4688157-4688179 CAGAATCAGAACATGGAGATTGG + Intergenic
1153686764 18:7553946-7553968 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1153909411 18:9693749-9693771 CAGAATCCAGAGTTGGAAAGGGG + Intergenic
1154401151 18:14038847-14038869 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1155012307 18:21792089-21792111 CAGAAGCAAGGGATACAGACAGG - Intronic
1155525927 18:26716135-26716157 CAGAGTCAAGAGATAGAGAAAGG + Intergenic
1155630412 18:27886494-27886516 CAGATCCCAGAGATGGAGGCAGG + Intergenic
1156403572 18:36761751-36761773 GAGAATCAACTGTTGGAGACAGG + Intronic
1156433124 18:37097333-37097355 CAAAAACAAGAAATGGAGAAAGG - Intronic
1156512208 18:37647554-37647576 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1156690168 18:39697799-39697821 TAGAACCAAGAGAAGGAGAAGGG - Intergenic
1156734062 18:40231076-40231098 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1156740835 18:40325663-40325685 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1156812666 18:41271789-41271811 CAGAAGCAAGAGAGGGAGGTGGG - Intergenic
1157206534 18:45705051-45705073 CAGAAACAAGAAATGGAGAAAGG + Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157845757 18:51002422-51002444 CAAAAACAAGAAATGGAGAAAGG + Intronic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158472764 18:57752301-57752323 CAGAATCAAGAAATGGTTAAGGG + Intronic
1158578086 18:58657251-58657273 CAGAAACAAGAGACAGAGAAAGG - Intergenic
1158750403 18:60252915-60252937 GAGAAGCAAGAGAGTGAGACTGG - Intergenic
1159089213 18:63828262-63828284 CAGAAGCAAGAGAGAGAGATGGG - Intergenic
1159102783 18:63973746-63973768 CAAAAACAAGAAATGGAGAACGG - Intronic
1159823731 18:73178732-73178754 GAGAATCAAGAGATGGAGAGGGG + Intronic
1164970157 19:32525063-32525085 AAGAAACAAGAGATTGAGGCTGG + Intergenic
1165334215 19:35157671-35157693 CAGAACCAAGAGGTGGAGAGAGG - Intronic
1165594542 19:37001233-37001255 GAGAATCAAGAGTCTGAGACTGG + Intergenic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166161812 19:40959625-40959647 CACAAAGAAGAGATGGAGACAGG - Intergenic
1166226586 19:41399482-41399504 GGTAATCAAGAGATTGAGACAGG - Intronic
1166724057 19:45014879-45014901 CTGAATCCAGATTTGGAGACAGG - Intronic
1167019283 19:46861633-46861655 CACAATTAAGAGATGCAGAATGG - Intergenic
1167303007 19:48690264-48690286 AAGAATCAGGACTTGGAGACTGG + Intergenic
1167490529 19:49790378-49790400 AAGGATCATGAGATGGAGAGAGG - Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167841050 19:52120500-52120522 CACAATCAGAAGATAGAGACTGG + Intronic
1168373754 19:55858444-55858466 CTGAAGCAAGAGATGCAGAAAGG + Exonic
925258885 2:2512485-2512507 CAGAAGCAAGAGGTGGACGCAGG + Intergenic
925792197 2:7501839-7501861 AGGAAGGAAGAGATGGAGACAGG + Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926924221 2:17970374-17970396 CAGCATTAAGTGGTGGAGACAGG - Intronic
927242869 2:20933841-20933863 GAAAAACAAGAGAGGGAGACTGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
928677013 2:33660283-33660305 CAGAATCAGAACATGGAGATTGG + Intergenic
929343789 2:40855897-40855919 CAAAAACAAGAAATGGAGAAAGG + Intergenic
930211672 2:48645560-48645582 CAAAATCAAGAGATGGTGCTCGG - Intronic
930451260 2:51540901-51540923 CAAAAACAAGAAATGGAGAAAGG + Intergenic
930733412 2:54750582-54750604 CACAGCCAAGAGATGGAGAAAGG - Intronic
931558916 2:63535592-63535614 CAAAAACAAGAAATGGAGAAAGG + Intronic
932080919 2:68714469-68714491 CAGAAGAAAGAGATAGATACAGG - Intronic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
932917633 2:75875184-75875206 CAGAATCAGAACATGGAGATTGG + Intergenic
933175296 2:79167028-79167050 CAGAATCAGAACATGGAGAATGG - Intergenic
933202307 2:79465243-79465265 CAAAAACAAGAAATGGAGAAAGG - Intronic
933583588 2:84155032-84155054 CAGAAGCAAGAGAGAGAGAATGG - Intergenic
934549953 2:95253343-95253365 CAGAAACAAGAAATGGGGAAAGG - Intronic
934672103 2:96220816-96220838 CAGAATCAGAATATGGAGATTGG - Intergenic
935569272 2:104642037-104642059 CAGCCACAAGAGATGGAGACAGG + Intergenic
935937068 2:108197670-108197692 CAAAAACAAGAAATGGAGAAAGG + Intergenic
935937696 2:108204395-108204417 CAAAAACAAGAAATGGAGAAAGG - Intergenic
936387341 2:112042010-112042032 CAGAATCAGAACATGGAGATTGG - Intergenic
936684929 2:114816548-114816570 CACAATCAAGAGATGGGGTGGGG - Intronic
937196288 2:120159784-120159806 CAGAAACAAGCAATGGAGAAAGG + Intronic
937213809 2:120297410-120297432 CAGGGTCAAGAGATGGTGGCAGG - Intergenic
937762595 2:125623604-125623626 CCCAATTAAAAGATGGAGACTGG + Intergenic
938041215 2:128077811-128077833 CTGAAACAAGAGATGAAGATTGG - Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
938947948 2:136230843-136230865 CAGAATCAAGTCATGGAGCCAGG - Intergenic
939017094 2:136915306-136915328 CTCAGTCCAGAGATGGAGACAGG + Intronic
939157231 2:138540005-138540027 CAAAAACAAGAAATGGGGACAGG - Intronic
939443398 2:142277596-142277618 GAGAAGAAAGAGATGGAGATGGG - Intergenic
939809407 2:146812751-146812773 CAGAAACAAGCAATGGAGAAAGG + Intergenic
939994840 2:148910495-148910517 CAGGATCCAGAGTTAGAGACTGG - Intronic
940081519 2:149808422-149808444 GAGAATCAAGAGGTGGTGTCTGG - Intergenic
940082546 2:149820860-149820882 CAAAAACAAGAAATGGAGAAAGG - Intergenic
940720326 2:157275088-157275110 CAAAAACAAGAAATGGAGAAAGG - Intronic
941197812 2:162471969-162471991 CAAAAACAAGAAATGGAGAAAGG + Intronic
941595646 2:167473675-167473697 CACAATCAAGAGATGGAAGAAGG + Intergenic
942580457 2:177411439-177411461 CAGAATCAGAACATGGAGATTGG - Intronic
942658018 2:178234840-178234862 CAGATTCAAGGAATGGAGTCTGG + Intronic
942699695 2:178691620-178691642 CATTATGAAGAGGTGGAGACAGG - Intronic
942737673 2:179134400-179134422 CAGATAGAAGAGATGGAGGCAGG - Intronic
942830766 2:180235777-180235799 CAGAATCAGAACATGGAGATTGG + Intergenic
942836036 2:180299664-180299686 CAAAAACAAGAAATGGAGAAAGG - Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
943558638 2:189435057-189435079 CAGAAACAAGAAATGGGGAAAGG + Intergenic
943600352 2:189911503-189911525 CAGAATCATGAGATAAATACTGG - Intronic
943987687 2:194643627-194643649 CAAAAACAAGAGATGGGGAAAGG + Intergenic
944893819 2:204144079-204144101 CAGAATCACGAGGTGGACTCTGG + Intergenic
945256822 2:207810144-207810166 CAGAATTTCAAGATGGAGACAGG + Intergenic
946240952 2:218355397-218355419 TACCATCAAGACATGGAGACTGG - Intergenic
947096094 2:226568538-226568560 CAGGAGCAAGAGAGGGAGAGAGG - Intergenic
947646642 2:231746845-231746867 CAGAACCAAGAGACAGAGCCAGG + Intronic
948131127 2:235601299-235601321 AAGGAGAAAGAGATGGAGACAGG + Intronic
948704579 2:239780891-239780913 CAGAACCAAGAGATGAAGAGGGG - Intronic
1170039324 20:12023578-12023600 CAGAATCAGGAAGTGGAGAAGGG + Intergenic
1170091762 20:12596859-12596881 AAGAGTGAAGAGATAGAGACAGG - Intergenic
1170163840 20:13342915-13342937 GAGAAACAAGAGATCGTGACTGG + Intergenic
1171057530 20:21921646-21921668 CAGAATCAAAAGTTGGGAACCGG + Intergenic
1171200520 20:23237471-23237493 CAAAATCAAGCAATGGAGAAAGG - Intergenic
1171903506 20:30878949-30878971 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1172351899 20:34249602-34249624 AAAAATTAAGAGATGGTGACAGG - Intronic
1172632454 20:36388183-36388205 AAGAATCAAGAAGTGGGGACGGG - Intronic
1173421448 20:42904798-42904820 CAGAAACAAGAAATGGGGAAAGG + Intronic
1174389911 20:50212628-50212650 CAGAATCAAGGGATGGGGCCAGG - Intergenic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1177088125 21:16732333-16732355 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1177480561 21:21681650-21681672 CAAAGTAAAGGGATGGAGACAGG - Intergenic
1177693061 21:24535631-24535653 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1177759834 21:25390938-25390960 TAGAATGAAGAGGAGGAGACTGG - Intergenic
1179259164 21:39743144-39743166 CAGAATCAGAACATGGAGATTGG - Intergenic
1180318367 22:11298323-11298345 CAGAAGCCAGAGATGGTAACTGG + Intergenic
1180336902 22:11584908-11584930 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1180990834 22:19934892-19934914 CAGGATTAAGAGATAAAGACAGG - Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181722324 22:24785481-24785503 CAAGGTCAAGAGATCGAGACCGG - Intergenic
1181742517 22:24932770-24932792 TAGAAGCACGAGATGGAGAGAGG - Intergenic
1182042686 22:27250634-27250656 AAGAAGCAAGAGATGGGGTCAGG + Intergenic
1182074978 22:27489290-27489312 CAGAATCAGGAAATTGACACTGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183730228 22:39614439-39614461 CTGAAGCAAGAGCTGGAGAGAGG - Intronic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
949816099 3:8059959-8059981 CAGAAACAAGAAATGGGGAAAGG - Intergenic
950747274 3:15100422-15100444 CAGAAGCTAGTGATGGAGACGGG - Intergenic
951142049 3:19174062-19174084 CAGAATCAAGCGGTGTAGAGTGG - Intronic
951200717 3:19873296-19873318 CAGAATCAGAACATGGAGATTGG - Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951847798 3:27103380-27103402 CAGAATCCTGGGATGGGGACTGG + Intergenic
952575363 3:34767953-34767975 CAGAAACAAGAAATGGGGAAAGG + Intergenic
952587374 3:34908980-34909002 CAGAAACAAGAAATGGGGAAAGG + Intergenic
952800419 3:37285433-37285455 CATAATCAACAGATGAAAACTGG - Intronic
952854497 3:37757935-37757957 CAGAAACCAGAAATGGAGAGCGG + Intronic
953080861 3:39616253-39616275 CAAAATCAAGAAATGGGGAAAGG - Intergenic
953099464 3:39810332-39810354 CAGAATTAAGAGTTTGAGTCAGG - Intronic
953539348 3:43802142-43802164 CAAAAACAAGAAATGGAGAAAGG - Intergenic
953571559 3:44075804-44075826 GAGAATCAAGAGATGGGGTGTGG + Intergenic
954182315 3:48891010-48891032 CACTACCAAGACATGGAGACTGG - Intronic
954572373 3:51652660-51652682 CAGAAACAAGAAATGGGGAAAGG + Intronic
954828374 3:53396010-53396032 CAGAAGCAAGAAATGGGGAAAGG + Intergenic
954833304 3:53441998-53442020 CAGAAACAAGAAATGGGGAAAGG - Intergenic
954836064 3:53469221-53469243 CAGAAACAAGAAATGGAGAAAGG - Intergenic
955282875 3:57611114-57611136 CAAAAACAAGAAATGGAGAAAGG + Intergenic
955642531 3:61101320-61101342 CAAAATCAAGAAATGGGGAAAGG - Intronic
956035896 3:65091566-65091588 CAGAATCAAGAAATGGTAAGAGG + Intergenic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957395204 3:79627382-79627404 CAAAATCAAGCAATGGAGAAAGG + Intronic
957629639 3:82702673-82702695 CAAAAACAAGTGATGGAGAAAGG - Intergenic
958016294 3:87943103-87943125 CAGAATCAGAACATGGAGATTGG - Intergenic
958030208 3:88099705-88099727 CAAAAACAAGAAATGGAGAAAGG + Intronic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
958176367 3:90000835-90000857 CAAAAACAAGAAATGGAGAAAGG + Intergenic
958629834 3:96671147-96671169 CAGAATCAGAACATGGAGATAGG - Intergenic
958881837 3:99680870-99680892 CAGAAACAAGAAATGGAGAAAGG + Intronic
958903065 3:99910926-99910948 AAGGATGAAGAGATGGAGACTGG + Intronic
958953904 3:100446331-100446353 CAAAAACAAGAAATGGAGAAAGG + Intronic
959912738 3:111782084-111782106 CAGGGTCAAGATATGGAGATAGG + Intronic
959939717 3:112068084-112068106 CAAAAACAAGAAATGGAGAAAGG - Intronic
959944980 3:112116639-112116661 TAGAATGAAGTGATGGAGGCTGG + Exonic
959955619 3:112234737-112234759 CAAAAACAAGAAATGGAGAAAGG - Intronic
960319921 3:116222033-116222055 CAATATCAAGTGATGGAGAATGG - Intronic
960620988 3:119636527-119636549 CAGAAACAGAAGATGGTGACTGG + Intronic
960770215 3:121185557-121185579 CAAAAACAAGAAATGGAGAAAGG - Intronic
960911780 3:122656527-122656549 CAAAAACAAGAAATGGAGAAAGG + Intergenic
961664490 3:128487425-128487447 CAGACTCAAAAGTTGGAGACAGG + Intronic
962096079 3:132294484-132294506 CAGAACCAAGAGATAAAGATTGG + Intergenic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962612332 3:137089435-137089457 CAGAAACAAGAGACAGAGAGGGG + Intergenic
962861732 3:139409466-139409488 CAAAAACAAGAAATGGAGAAAGG + Intergenic
963187915 3:142439377-142439399 CAGAATCAGAACATGGAGATTGG + Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965054827 3:163698800-163698822 CAGAATCAGAACATGGAGATTGG - Intergenic
965161187 3:165135651-165135673 CAGAAACAAGAAATGGGGAAAGG - Intergenic
965591588 3:170365212-170365234 CAGAATCAGGAGTTGAATACAGG + Intronic
966215742 3:177500390-177500412 AAGAGTCACGGGATGGAGACTGG + Intergenic
966353466 3:179055946-179055968 CAGAATCAGAACATGGAGATTGG + Intronic
966390414 3:179447319-179447341 CATGATCAAGAGACGGTGACTGG - Intronic
967265562 3:187688178-187688200 CAGGATCTGGAGATGAAGACAGG + Intergenic
967278327 3:187798260-187798282 CAGAGTCAAGAGAGGAAGACAGG + Intergenic
967578898 3:191128143-191128165 GACAATGAAGAAATGGAGACAGG + Intergenic
967623531 3:191661709-191661731 CAGAATCAGAACATGGAGATTGG + Intergenic
967834979 3:193954508-193954530 CTGAATTAAAAGATGTAGACTGG - Intergenic
968391209 4:194416-194438 CAGAATCAGAACATGGAGATTGG - Intergenic
969422065 4:7103315-7103337 TAGAATCAAGAGTTGGAACCTGG + Intergenic
970756340 4:19431067-19431089 CAGGCTCAAGAGATAGAAACTGG + Intergenic
971466720 4:26971503-26971525 CAAAAACAAGAAATGGAGAAAGG - Intronic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
971508597 4:27395698-27395720 CAGAATCCAGAGAGAAAGACTGG - Intergenic
971753888 4:30683388-30683410 CAGGATTAAGAGATTAAGACAGG + Intergenic
971766186 4:30835190-30835212 CAGAGTCAGCAGATTGAGACAGG + Intronic
972781378 4:42289656-42289678 CAGAATCAGAACATGGAGATTGG - Intergenic
973112110 4:46409530-46409552 CAAAAACAAGAAATGGAGAAAGG + Intronic
973315716 4:48757967-48757989 CAAAAACAAGAAATGGAGAAAGG + Intronic
974520435 4:62975129-62975151 CAGAATCAGAACATGGAGATTGG + Intergenic
974837583 4:67269458-67269480 CAGAAACAAGAAATGGGGAAAGG - Intergenic
974966673 4:68769470-68769492 CAAAAACAAGAAATGGAGAAAGG - Intergenic
974979669 4:68939430-68939452 CAAAATCAAGAAATGGAGAAAGG + Intronic
975218057 4:71780115-71780137 CAAAAACAAGAAATGGAGAAAGG + Intronic
975313849 4:72930413-72930435 CAGAATCAGAACATGGAGATTGG - Intergenic
975638811 4:76478411-76478433 CAGAATCTAGAGAGGCAGTCTGG - Intronic
976189810 4:82477136-82477158 CAGAATCAGAACATGGAGATTGG + Intergenic
976464745 4:85354489-85354511 CAGAATCAGAACATGGAGATTGG - Intergenic
976512925 4:85931434-85931456 CAGAATCAAAACAAGGTGACGGG - Intronic
976534306 4:86193459-86193481 CAGAATCTAGAGAGGCAGTCTGG + Intronic
976625156 4:87172357-87172379 CAGAATCAAGAGATTGGGCTAGG - Intronic
976834058 4:89349770-89349792 CAAAAACAAGAAATGGAGAAAGG - Intergenic
977505531 4:97898163-97898185 CAAAATCAAGCAATGGAGACAGG - Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
977843544 4:101740169-101740191 CAGAAACAAGAAATGGGGAAGGG - Intronic
977977215 4:103279623-103279645 CAAAATCAAGAAATGGGGAAAGG + Intergenic
978007078 4:103630071-103630093 CAAAAACAAGAAATGGAGAAAGG + Intronic
978586835 4:110283074-110283096 CAGAATCAGAACATGGAGATTGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979074335 4:116253167-116253189 CAAAAACAAGAAATGGAGAAAGG - Intergenic
979321062 4:119325528-119325550 CAAAAACAAGAAATGGAGAAAGG - Intergenic
979532059 4:121779510-121779532 CAGAAACAATAGCTGGAGAATGG - Intergenic
979567057 4:122166333-122166355 CAAAATCAAGAAATGGGGAAAGG - Intronic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
980204279 4:129697686-129697708 CAGTAGCAAGGGATGGAGAACGG + Intergenic
980336055 4:131474805-131474827 CAAAAACAAGAAATGGAGAAAGG - Intergenic
980555121 4:134393819-134393841 CAGCTTCAAGATATGGAGAGCGG + Intergenic
980743971 4:136991402-136991424 CAGAACCAAGAGATGGAAGTAGG - Intergenic
980902354 4:138916860-138916882 CAGTTTGAAGGGATGGAGACAGG - Intergenic
981074274 4:140575913-140575935 CAGGATCAATAGACGGACACAGG - Intergenic
981089412 4:140717212-140717234 CTGAACCAGGAGATGCAGACAGG + Intronic
981299983 4:143176161-143176183 CAAAAACAAGAAATGGAGAAAGG + Intergenic
981513121 4:145579207-145579229 CAAAAACAAGAAATGGAGAAAGG + Intergenic
981553713 4:145968103-145968125 CAGAATCTAGAGAGGCAGTCTGG + Intergenic
982929303 4:161382269-161382291 CAGAATGAAGACATGGATAAGGG - Intergenic
983826912 4:172273905-172273927 CAGAAGCAAGAGAAGCAGTCAGG + Intronic
984315868 4:178130377-178130399 TAGAATGAAGACATGGAGAAGGG + Intergenic
984398992 4:179237728-179237750 CTGAATCAAGAGATAGTGACAGG + Intergenic
985929291 5:3043707-3043729 ATGGATAAAGAGATGGAGACAGG - Intergenic
986027005 5:3860075-3860097 CAGAAGCCAGAGAGAGAGACAGG - Intergenic
986279087 5:6308249-6308271 CAGATTGAAGAAATGGAGAGGGG + Intergenic
986425882 5:7631089-7631111 CAGAATCAAAAGTCAGAGACAGG - Intronic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
988072221 5:26307304-26307326 CAAAAACAAGAAATGGAGAAAGG + Intergenic
988221645 5:28353930-28353952 CAGAAACAAGAAATGGGGAAAGG + Intergenic
989217257 5:38918207-38918229 CAGAACCCAGACATGCAGACTGG - Intronic
989341998 5:40386551-40386573 CCGAATCAAAAGCTGGAGAGGGG + Intergenic
990768629 5:59216933-59216955 CACAATCTAGGAATGGAGACCGG - Intronic
990892216 5:60661838-60661860 CAGAATCAGAACATGGAGATTGG + Intronic
990913408 5:60877139-60877161 CAAAAACAAGAAATGGAGAAAGG - Intronic
990924710 5:61007376-61007398 CAAAAACAAGAGATGGGGAAAGG - Intronic
991215216 5:64152123-64152145 AGGAATCAAAAGGTGGAGACAGG - Intergenic
991234333 5:64376575-64376597 AAGAATCAAGACATGGAAACAGG + Intergenic
991397731 5:66222560-66222582 AAGAATCTAGAGATGCAGTCTGG + Intergenic
991424977 5:66481457-66481479 CAAAAACAAGAAATGGAGAAAGG - Intergenic
992659079 5:78940544-78940566 CAGAAACAAGAAATGGGGAAAGG - Intronic
992800913 5:80295194-80295216 AAGAAAGAAAAGATGGAGACTGG + Intergenic
993527853 5:88988679-88988701 CAAAAACAAGAAATGGAGAAGGG - Intergenic
994513762 5:100743310-100743332 AAGAATCAAGAGAGGGATACAGG + Intergenic
994623264 5:102188354-102188376 CAGAAACAAGCAATGGAGAAAGG - Intergenic
995465612 5:112447170-112447192 CAGAATCAGAACATGGAGATTGG + Intergenic
997213132 5:132089358-132089380 CAGAACCAAGAGATAAAAACAGG - Intergenic
997305877 5:132836115-132836137 CAGAAGCAAGAGAGGGGGAGGGG - Intergenic
998009190 5:138679937-138679959 CAAAAACAAGAAATGGGGACAGG - Intronic
998050480 5:139028677-139028699 CAAAATCAAGAAAAGGACACAGG + Intronic
998549435 5:143063221-143063243 CAGATTCAAGAGATAGAAAAGGG - Intronic
998727461 5:145034072-145034094 CAGAATCAAGGCCTAGAGACTGG - Intergenic
999093797 5:148959891-148959913 CAGAATCATTTGATGCAGACTGG - Intronic
999416717 5:151404270-151404292 CAAAGTAAAGAGATGGAGAAAGG - Intergenic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999761129 5:154702017-154702039 CAGGATTGAGTGATGGAGACAGG + Intergenic
1000287586 5:159840110-159840132 GAGAGTCAAGAGATGGAGAGGGG - Intergenic
1000588033 5:163123898-163123920 CAGAAGCACGAGATCTAGACTGG + Intergenic
1000709063 5:164548194-164548216 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1001202135 5:169727936-169727958 AGAAAGCAAGAGATGGAGACGGG + Intronic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003380407 6:5619805-5619827 AAGAATGAAGAGAGGGAGACAGG - Intronic
1004069921 6:12288612-12288634 CTGAAGCAAGAGTTGGAGATGGG - Intergenic
1004135605 6:12963105-12963127 CAGAATTCAGAGAAAGAGACAGG + Intronic
1004138389 6:12990801-12990823 GAGAATCAGGAGCTGGAGAGGGG + Intronic
1004236789 6:13881488-13881510 CAGAATCAGAACATGGAGATTGG + Intergenic
1004565560 6:16792903-16792925 GACAATCAAGAGATGGCAACAGG + Intergenic
1004666412 6:17752177-17752199 GAGAATCAGGAGGTTGAGACTGG + Intergenic
1004730638 6:18355043-18355065 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1005055917 6:21728666-21728688 CAAGGTCAAGAGATCGAGACAGG - Intergenic
1005212200 6:23479554-23479576 CAGAATCAAGAAATTAACACTGG - Intergenic
1006339452 6:33438674-33438696 CAGAATCAGGTGTTGGAGGCTGG - Intronic
1007077570 6:39077805-39077827 CAGAATCCTGGAATGGAGACAGG - Intronic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007434184 6:41796786-41796808 CAAAATCAGGAGATGAAGAAAGG + Intronic
1008147207 6:47906439-47906461 CGCATTCAAGAGATGGAGCCTGG + Intronic
1008361517 6:50624723-50624745 CAAAAGCAAGAAATGGGGACAGG + Intergenic
1008363157 6:50645286-50645308 CAAAAACAAGAAATGGGGACAGG - Intergenic
1008629099 6:53347439-53347461 CAGAATCTACAGATAGAAACAGG - Intronic
1009314414 6:62199966-62199988 CAAAAACAAGAAATGGAGAAAGG + Intronic
1009384437 6:63071536-63071558 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1009478805 6:64129889-64129911 CAGAAACAAGAAATGGGGAAAGG - Intronic
1009718028 6:67426311-67426333 CAAAATAAAGGGATGGAGAAAGG - Intergenic
1009720218 6:67458854-67458876 CAGGATTAAGAGATTAAGACAGG + Intergenic
1009720219 6:67458873-67458895 CAGGATTAAGAGATTAAGACAGG + Intergenic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1010339016 6:74725428-74725450 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1010997317 6:82548693-82548715 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1011147838 6:84238377-84238399 CAAAATCAAGCGATGGGGAAAGG + Intergenic
1011189809 6:84717115-84717137 CAGAATCAGAACATGGAGATTGG - Intronic
1011407845 6:87034491-87034513 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1011539893 6:88418043-88418065 CAGAATCAGAACATGGAGATTGG - Intergenic
1011869546 6:91875473-91875495 CAGAGGCAAAATATGGAGACTGG + Intergenic
1012471710 6:99579877-99579899 CAGGAGCAAGAGGTGGAGGCTGG - Intergenic
1012528982 6:100211773-100211795 CAGAATCCAGAAAGGAAGACTGG + Intergenic
1012529136 6:100213442-100213464 CAGCAACAAGAGATCGACACAGG + Intergenic
1012537099 6:100312510-100312532 GAGAGTCAAAGGATGGAGACGGG + Intergenic
1013022209 6:106231461-106231483 CAGAATCAGAACATGGAGATTGG + Intronic
1013518248 6:110909161-110909183 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013610165 6:111787325-111787347 CAGAAACAAGAAATGGGGAAAGG - Intronic
1013995437 6:116302901-116302923 CAAAAACAAGAAATGGAGACAGG - Intronic
1014177768 6:118349012-118349034 CAGAAGGAAGAGAGGGAGAGAGG - Intergenic
1014462042 6:121707812-121707834 CAAAAACAAGAAATGGGGACAGG + Intergenic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1014881663 6:126731123-126731145 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1015107966 6:129559048-129559070 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1016072113 6:139751313-139751335 CAGAATCAAGAGGTGGGGGTGGG + Intergenic
1016343284 6:143084837-143084859 CAGAATCAGAACATGGAGATTGG - Intronic
1016444749 6:144120200-144120222 CAGAATCAGAACATGGAGATTGG - Intergenic
1016702857 6:147073057-147073079 GGGAAAAAAGAGATGGAGACGGG + Intergenic
1017280070 6:152613867-152613889 CAGAAACAAGAAATGGGGAAAGG + Intronic
1017926584 6:158915898-158915920 GAAAATGAAGAGATGGAGGCCGG + Intergenic
1018687485 6:166315270-166315292 CAGAATCAGAACATGGAGATTGG + Intergenic
1018761015 6:166894392-166894414 CAGAATCAGAACATGGAGATTGG + Intronic
1019727503 7:2611217-2611239 CACAAGCAAGAGATGGGCACTGG - Exonic
1019880977 7:3860710-3860732 CAGTTTCAAGAGATGAATACAGG - Intronic
1020473984 7:8573446-8573468 AAGAGTCAACAGATAGAGACAGG + Intronic
1020609512 7:10377420-10377442 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1022300520 7:29098217-29098239 CTGACTCAAGAGAAGGTGACTGG + Intronic
1022636814 7:32144006-32144028 CTGAATTGAGAGATGGAGATGGG + Intronic
1023439326 7:40170102-40170124 CAGAATCAGAACATGGAGATTGG - Intronic
1023460477 7:40391015-40391037 CAGAAACAAGAAATGGGGAAAGG + Intronic
1023501488 7:40854757-40854779 AAAAATCTAGAGATGGGGACTGG - Intronic
1024031422 7:45463685-45463707 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1024671057 7:51595258-51595280 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1024817061 7:53283619-53283641 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1024955854 7:54918762-54918784 CAGAATCAAAAGACAGAGAGAGG + Intergenic
1026664305 7:72329333-72329355 CAGAATGGACAGCTGGAGACAGG + Intronic
1027473862 7:78605916-78605938 CAGCATCAAGAGAGAAAGACAGG + Intronic
1027811347 7:82904269-82904291 CAGACAAAAGAGATAGAGACAGG - Intronic
1028316335 7:89407179-89407201 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1028392138 7:90328808-90328830 CAATATCAAGTGTTGGAGACTGG + Intergenic
1028450290 7:90974386-90974408 CAGGATTAAGAGATTAAGACAGG + Intronic
1028588616 7:92474510-92474532 CAGAATCAGAACATGGAGATTGG - Intronic
1028977463 7:96930016-96930038 TAGAATAAATAGAGGGAGACAGG - Intergenic
1029004235 7:97190823-97190845 CAGAAGCAAGCAATGGAGAAAGG + Intergenic
1029186134 7:98740100-98740122 GAGAATCATGTGATGGACACTGG + Intergenic
1029202495 7:98848362-98848384 CAGATGCAAGAGATGGATATAGG + Intronic
1030337263 7:108340610-108340632 CAGAATCAAAACACGGAGATTGG + Intronic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1030843522 7:114382958-114382980 CAGAATCAGAACATGGAGATTGG - Intronic
1031312803 7:120219722-120219744 AAGAATCAATGGATGGAGCCAGG - Intergenic
1031471494 7:122173788-122173810 CAGAATCAGAACATGGAGATTGG + Intergenic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1032426121 7:131823486-131823508 CAGAATCAGAACATGGAGATTGG - Intergenic
1032728841 7:134617543-134617565 CAGAATCAAGAGACTCAGAGAGG - Intergenic
1032800526 7:135314055-135314077 CAGATTCTAGAGGGGGAGACAGG - Intergenic
1032876102 7:136039878-136039900 AAAAATCAAGAGAGGAAGACTGG - Intergenic
1032883020 7:136110162-136110184 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1033484094 7:141771216-141771238 CAAAAACAAGAAATGGAGAAAGG - Intronic
1033542058 7:142366267-142366289 CAGGAGCAAGAGATAGAGAGTGG + Intergenic
1034659097 7:152753669-152753691 CAGAATCCAGAGATGAAATCTGG - Intergenic
1035348105 7:158221098-158221120 CAAAAACAAGAAATGGAGAAAGG + Intronic
1035693631 8:1576724-1576746 CAAAAACAAGAAATGGAGAAAGG - Intronic
1037570967 8:20157435-20157457 CAGAATCACAACATGGAGATTGG + Intronic
1037584115 8:20264806-20264828 CAGAATAAAGGGTTGGAGCCTGG - Intronic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1038133066 8:24755458-24755480 CAGATTCATGAGTAGGAGACTGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1040059628 8:43093360-43093382 CAGAAGCCAGACAGGGAGACTGG + Intergenic
1040606680 8:48940351-48940373 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1040679349 8:49789882-49789904 AGGAATCAAGAGATGGGGATGGG + Intergenic
1040771882 8:50987743-50987765 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1040776686 8:51052357-51052379 CATAAACAAGTGGTGGAGACTGG - Intergenic
1041130013 8:54688572-54688594 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1041663899 8:60424155-60424177 CAGAATCAGAACATGGAGATTGG - Intergenic
1041913147 8:63111128-63111150 CACAATGAAGAGATTGAGAGGGG + Intergenic
1042056080 8:64766140-64766162 CAGAATCAGAACATGGAGATTGG + Intronic
1042597106 8:70461482-70461504 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1043188817 8:77190661-77190683 CAGAAGTAAGAAATGGAGAAAGG + Intergenic
1043364016 8:79510485-79510507 CAGATCCAAGAGATGGTGGCTGG + Intergenic
1043378771 8:79680383-79680405 CAAAATCAAGAAATGGGGAAAGG + Intergenic
1043688263 8:83115963-83115985 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1043725566 8:83606299-83606321 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1043806728 8:84681110-84681132 CAAAATCAAGAAATGGGGAAAGG - Intronic
1044074202 8:87798102-87798124 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1044200496 8:89429557-89429579 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1044349710 8:91149344-91149366 CAAAAACAAGAAATGGAGAAAGG - Intronic
1045212964 8:100118122-100118144 CAAAAACAAGAAATGGAGAAAGG + Intronic
1045360713 8:101430601-101430623 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1045647449 8:104313445-104313467 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1045978244 8:108153933-108153955 CAGAAACAAGTAATGGAGAAAGG + Intergenic
1046147050 8:110174005-110174027 CAGAAGCAGGAGGTGGAGAGGGG + Intergenic
1047865127 8:129015082-129015104 CAAAATCAAGCAATGGAGAAAGG - Intergenic
1047894122 8:129345919-129345941 CAGACATAAGAGATGGAGATAGG + Intergenic
1048287198 8:133151151-133151173 CACCATCCAGAGAGGGAGACAGG - Intergenic
1048685181 8:136896994-136897016 AAGAATCAGAAAATGGAGACTGG + Intergenic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050597733 9:7220860-7220882 CAAAAACAAGAAATGGGGACAGG + Intergenic
1050855099 9:10344288-10344310 CAAAAACAAGAAATGGAGAAAGG - Intronic
1050901224 9:10951375-10951397 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1051341264 9:16113036-16113058 TTGAGTTAAGAGATGGAGACTGG + Intergenic
1051453606 9:17226861-17226883 CAGGAGCAAGAGAGAGAGACAGG + Intronic
1052115022 9:24639987-24640009 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1052419371 9:28222820-28222842 CAAAATCAAGATATGAAGAGGGG + Intronic
1052538546 9:29777888-29777910 CAGAATCAGAATATGGAGATTGG - Intergenic
1052779985 9:32771697-32771719 CAGAAACAAGCAATGGAGAAAGG - Intergenic
1053036487 9:34831158-34831180 CACAATGAAGAGATGTAGAAGGG + Intergenic
1053194113 9:36102018-36102040 CAGAAACAAGTGATGTTGACTGG + Intronic
1055018247 9:71642446-71642468 CATAAGCAAGAGAGGGAGAGAGG + Intergenic
1055300028 9:74873090-74873112 TAGAATGTAGAGATGGAGGCAGG - Intronic
1056543920 9:87597188-87597210 CAGATTCAAGGGTTAGAGACTGG + Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056728476 9:89142999-89143021 CAGACTCAAGAGAGGGATATTGG + Intronic
1058096871 9:100871652-100871674 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1060498186 9:124133240-124133262 GAGACTCAAGAGATGGAGTGAGG + Intergenic
1061124871 9:128668257-128668279 CAAGGTCAAGAGATCGAGACTGG - Intergenic
1061664699 9:132153728-132153750 CAGAACCAAGAGAGGAAGTCGGG + Intergenic
1062271422 9:135711461-135711483 CAGGAACTAGGGATGGAGACTGG + Intronic
1203366595 Un_KI270442v1:264085-264107 CAGAAGCCAGAGATGGTAACTGG + Intergenic
1186122791 X:6381798-6381820 CAGAATCCAGAGATGTAGAAGGG - Intergenic
1186204039 X:7182720-7182742 CAGAGTCTAGAGAGGTAGACAGG - Intergenic
1187197839 X:17105154-17105176 CAGACTCCAGTGATGGTGACAGG - Intronic
1187249729 X:17586077-17586099 CAGAACCAAGACAAGGAGATGGG - Intronic
1187347322 X:18478256-18478278 AAGAAACAAACGATGGAGACTGG - Intronic
1187616710 X:21002815-21002837 ACGAATCTAGAGAAGGAGACAGG - Intergenic
1187713407 X:22076909-22076931 CAGACCCAAGATATTGAGACAGG - Intronic
1188437839 X:30182843-30182865 CACAATCAAGAAATGCAAACAGG + Intergenic
1188444753 X:30244707-30244729 CACACTTGAGAGATGGAGACTGG + Intronic
1189192673 X:39123925-39123947 CAGAATGGAGAGATGAAGAGAGG - Intergenic
1189255945 X:39639212-39639234 CACAATGGAGAAATGGAGACTGG + Intergenic
1189964021 X:46353350-46353372 AAGAATCAAGGGATGGAAATGGG - Intergenic
1190100453 X:47518734-47518756 AAGGATCAAGAAATGGAGATGGG - Intergenic
1190482989 X:50896339-50896361 CGGAGTCAAGAGAGAGAGACAGG + Intergenic
1190990004 X:55536927-55536949 CAGAAACAAGACATTGAGAGTGG - Intergenic
1191157608 X:57292079-57292101 CAAAACCAAGAGTTGGAGAGTGG - Intronic
1191167119 X:57402781-57402803 CAGAATCAGAACATGGAGATTGG - Intronic
1191589093 X:62861003-62861025 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1191801165 X:65081318-65081340 CTGAATCAAAAGATGTAGAGAGG + Intergenic
1192003794 X:67187719-67187741 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1192707434 X:73541318-73541340 AAGAATCTAGAGATGCAGACTGG - Intergenic
1193171998 X:78347607-78347629 CAGAATCAGAACATGGAGATTGG - Intergenic
1193306681 X:79959240-79959262 CAGAATCAGAACATGGAGATTGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194648879 X:96491288-96491310 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1194844382 X:98786304-98786326 CAGATTCAAGAGGAGGAAACAGG - Intergenic
1195665520 X:107426579-107426601 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1195867255 X:109446506-109446528 CAAAATCAAGAAATGGGGAAAGG + Intronic
1196068911 X:111497648-111497670 CAGAATCAGGATTTGGATACAGG + Intergenic
1196137050 X:112221453-112221475 AAGAACCAAGAGATAGAGACAGG - Intergenic
1196280682 X:113820452-113820474 CAGAAACAAGCAATGGAGAAAGG - Intergenic
1197708674 X:129651330-129651352 CAGAATCAAAAGTAGGAAACAGG - Intronic
1198042559 X:132868068-132868090 CAAAATAAAGGGATGGAGAAAGG + Intronic
1198168812 X:134084323-134084345 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1198337715 X:135683517-135683539 CAAAAACAAGAAATGGGGACAGG + Intergenic
1198709827 X:139489547-139489569 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1198752215 X:139947189-139947211 CAGAATGCAGAGAAGGCGACAGG - Intergenic
1199181173 X:144855530-144855552 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1199344508 X:146722844-146722866 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1199364032 X:146957336-146957358 CAGGATTAAGAGATTAAGACAGG - Intergenic
1199547272 X:149019343-149019365 CAGAGAGAAGAAATGGAGACTGG + Intergenic
1199789801 X:151142159-151142181 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1200689256 Y:6290064-6290086 CAGAAACAAGAAATGGGGAAAGG - Intergenic
1201046016 Y:9884657-9884679 CAGAAACAAGAAATGGGGAAAGG + Intergenic
1201286408 Y:12382417-12382439 TAGAGGCAAGAGATGGACACAGG + Intergenic
1201474578 Y:14366603-14366625 CAGAATCCAGAGCTGTAGAAGGG + Intergenic
1202591186 Y:26485174-26485196 CAAAAACAAGCGATGGAGAAAGG - Intergenic