ID: 999512918

View in Genome Browser
Species Human (GRCh38)
Location 5:152271560-152271582
Sequence AGTAGATATTTGTGTGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512918_999512924 20 Left 999512918 5:152271560-152271582 CCCAAACCACACAAATATCTACT No data
Right 999512924 5:152271603-152271625 CAATGCTGACACCCAGTGGCTGG No data
999512918_999512921 -9 Left 999512918 5:152271560-152271582 CCCAAACCACACAAATATCTACT No data
Right 999512921 5:152271574-152271596 ATATCTACTTTTCCTTTAAATGG No data
999512918_999512923 16 Left 999512918 5:152271560-152271582 CCCAAACCACACAAATATCTACT No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512918 Original CRISPR AGTAGATATTTGTGTGGTTT GGG (reversed) Intergenic
No off target data available for this crispr