ID: 999512919

View in Genome Browser
Species Human (GRCh38)
Location 5:152271561-152271583
Sequence AAGTAGATATTTGTGTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512919_999512921 -10 Left 999512919 5:152271561-152271583 CCAAACCACACAAATATCTACTT No data
Right 999512921 5:152271574-152271596 ATATCTACTTTTCCTTTAAATGG No data
999512919_999512923 15 Left 999512919 5:152271561-152271583 CCAAACCACACAAATATCTACTT No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data
999512919_999512924 19 Left 999512919 5:152271561-152271583 CCAAACCACACAAATATCTACTT No data
Right 999512924 5:152271603-152271625 CAATGCTGACACCCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512919 Original CRISPR AAGTAGATATTTGTGTGGTT TGG (reversed) Intergenic
No off target data available for this crispr