ID: 999512920

View in Genome Browser
Species Human (GRCh38)
Location 5:152271566-152271588
Sequence AGGAAAAGTAGATATTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512920_999512924 14 Left 999512920 5:152271566-152271588 CCACACAAATATCTACTTTTCCT No data
Right 999512924 5:152271603-152271625 CAATGCTGACACCCAGTGGCTGG No data
999512920_999512923 10 Left 999512920 5:152271566-152271588 CCACACAAATATCTACTTTTCCT No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512920 Original CRISPR AGGAAAAGTAGATATTTGTG TGG (reversed) Intergenic
No off target data available for this crispr