ID: 999512922

View in Genome Browser
Species Human (GRCh38)
Location 5:152271586-152271608
Sequence GCATTGCTTTGTCCATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512922_999512924 -6 Left 999512922 5:152271586-152271608 CCTTTAAATGGACAAAGCAATGC No data
Right 999512924 5:152271603-152271625 CAATGCTGACACCCAGTGGCTGG No data
999512922_999512923 -10 Left 999512922 5:152271586-152271608 CCTTTAAATGGACAAAGCAATGC No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data
999512922_999512927 24 Left 999512922 5:152271586-152271608 CCTTTAAATGGACAAAGCAATGC No data
Right 999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512922 Original CRISPR GCATTGCTTTGTCCATTTAA AGG (reversed) Intergenic
No off target data available for this crispr