ID: 999512923

View in Genome Browser
Species Human (GRCh38)
Location 5:152271599-152271621
Sequence AAAGCAATGCTGACACCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512918_999512923 16 Left 999512918 5:152271560-152271582 CCCAAACCACACAAATATCTACT No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data
999512920_999512923 10 Left 999512920 5:152271566-152271588 CCACACAAATATCTACTTTTCCT No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data
999512919_999512923 15 Left 999512919 5:152271561-152271583 CCAAACCACACAAATATCTACTT No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data
999512922_999512923 -10 Left 999512922 5:152271586-152271608 CCTTTAAATGGACAAAGCAATGC No data
Right 999512923 5:152271599-152271621 AAAGCAATGCTGACACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512923 Original CRISPR AAAGCAATGCTGACACCCAG TGG Intergenic
No off target data available for this crispr