ID: 999512925

View in Genome Browser
Species Human (GRCh38)
Location 5:152271614-152271636
Sequence GGTAATCTGAACCAGCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512925_999512931 6 Left 999512925 5:152271614-152271636 CCCAGTGGCTGGTTCAGATTACC No data
Right 999512931 5:152271643-152271665 TCTCAGAGAGAGGATCCCAAGGG No data
999512925_999512927 -4 Left 999512925 5:152271614-152271636 CCCAGTGGCTGGTTCAGATTACC No data
Right 999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG No data
999512925_999512930 5 Left 999512925 5:152271614-152271636 CCCAGTGGCTGGTTCAGATTACC No data
Right 999512930 5:152271642-152271664 CTCTCAGAGAGAGGATCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512925 Original CRISPR GGTAATCTGAACCAGCCACT GGG (reversed) Intergenic
No off target data available for this crispr