ID: 999512926

View in Genome Browser
Species Human (GRCh38)
Location 5:152271615-152271637
Sequence GGGTAATCTGAACCAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512926_999512930 4 Left 999512926 5:152271615-152271637 CCAGTGGCTGGTTCAGATTACCC No data
Right 999512930 5:152271642-152271664 CTCTCAGAGAGAGGATCCCAAGG No data
999512926_999512927 -5 Left 999512926 5:152271615-152271637 CCAGTGGCTGGTTCAGATTACCC No data
Right 999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG No data
999512926_999512931 5 Left 999512926 5:152271615-152271637 CCAGTGGCTGGTTCAGATTACCC No data
Right 999512931 5:152271643-152271665 TCTCAGAGAGAGGATCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512926 Original CRISPR GGGTAATCTGAACCAGCCAC TGG (reversed) Intergenic
No off target data available for this crispr