ID: 999512927

View in Genome Browser
Species Human (GRCh38)
Location 5:152271633-152271655
Sequence TACCCACAGCTCTCAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999512926_999512927 -5 Left 999512926 5:152271615-152271637 CCAGTGGCTGGTTCAGATTACCC No data
Right 999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG No data
999512925_999512927 -4 Left 999512925 5:152271614-152271636 CCCAGTGGCTGGTTCAGATTACC No data
Right 999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG No data
999512922_999512927 24 Left 999512922 5:152271586-152271608 CCTTTAAATGGACAAAGCAATGC No data
Right 999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999512927 Original CRISPR TACCCACAGCTCTCAGAGAG AGG Intergenic
No off target data available for this crispr