ID: 999513858

View in Genome Browser
Species Human (GRCh38)
Location 5:152280761-152280783
Sequence TTCCATTAGCTTGAGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999513854_999513858 6 Left 999513854 5:152280732-152280754 CCAGAATCTTGGGACCAATCTGA No data
Right 999513858 5:152280761-152280783 TTCCATTAGCTTGAGGTGTAGGG No data
999513850_999513858 18 Left 999513850 5:152280720-152280742 CCAACTAGGATCCCAGAATCTTG No data
Right 999513858 5:152280761-152280783 TTCCATTAGCTTGAGGTGTAGGG No data
999513855_999513858 -8 Left 999513855 5:152280746-152280768 CCAATCTGATTAAAATTCCATTA No data
Right 999513858 5:152280761-152280783 TTCCATTAGCTTGAGGTGTAGGG No data
999513849_999513858 19 Left 999513849 5:152280719-152280741 CCCAACTAGGATCCCAGAATCTT No data
Right 999513858 5:152280761-152280783 TTCCATTAGCTTGAGGTGTAGGG No data
999513853_999513858 7 Left 999513853 5:152280731-152280753 CCCAGAATCTTGGGACCAATCTG No data
Right 999513858 5:152280761-152280783 TTCCATTAGCTTGAGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999513858 Original CRISPR TTCCATTAGCTTGAGGTGTA GGG Intergenic
No off target data available for this crispr