ID: 999520582

View in Genome Browser
Species Human (GRCh38)
Location 5:152346753-152346775
Sequence TGGGTTCACCCCCAGTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999520582_999520584 -9 Left 999520582 5:152346753-152346775 CCTTTCCACTGGGGGTGAACCCA No data
Right 999520584 5:152346767-152346789 GTGAACCCAAGTTGCCTTCCCGG No data
999520582_999520585 -8 Left 999520582 5:152346753-152346775 CCTTTCCACTGGGGGTGAACCCA No data
Right 999520585 5:152346768-152346790 TGAACCCAAGTTGCCTTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999520582 Original CRISPR TGGGTTCACCCCCAGTGGAA AGG (reversed) Intergenic
No off target data available for this crispr