ID: 999522778

View in Genome Browser
Species Human (GRCh38)
Location 5:152369554-152369576
Sequence TGAGTGCCAATGGACACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999522778_999522786 3 Left 999522778 5:152369554-152369576 CCTCCAGTGTCCATTGGCACTCA No data
Right 999522786 5:152369580-152369602 AATAAACATAATGGAGTTGGGGG No data
999522778_999522785 2 Left 999522778 5:152369554-152369576 CCTCCAGTGTCCATTGGCACTCA No data
Right 999522785 5:152369579-152369601 CAATAAACATAATGGAGTTGGGG No data
999522778_999522782 0 Left 999522778 5:152369554-152369576 CCTCCAGTGTCCATTGGCACTCA No data
Right 999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG No data
999522778_999522781 -6 Left 999522778 5:152369554-152369576 CCTCCAGTGTCCATTGGCACTCA No data
Right 999522781 5:152369571-152369593 CACTCATCCAATAAACATAATGG No data
999522778_999522784 1 Left 999522778 5:152369554-152369576 CCTCCAGTGTCCATTGGCACTCA No data
Right 999522784 5:152369578-152369600 CCAATAAACATAATGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999522778 Original CRISPR TGAGTGCCAATGGACACTGG AGG (reversed) Intergenic
No off target data available for this crispr