ID: 999522782

View in Genome Browser
Species Human (GRCh38)
Location 5:152369577-152369599
Sequence TCCAATAAACATAATGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999522779_999522782 -3 Left 999522779 5:152369557-152369579 CCAGTGTCCATTGGCACTCATCC No data
Right 999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG No data
999522775_999522782 6 Left 999522775 5:152369548-152369570 CCCTTACCTCCAGTGTCCATTGG No data
Right 999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG No data
999522777_999522782 5 Left 999522777 5:152369549-152369571 CCTTACCTCCAGTGTCCATTGGC No data
Right 999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG No data
999522778_999522782 0 Left 999522778 5:152369554-152369576 CCTCCAGTGTCCATTGGCACTCA No data
Right 999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG No data
999522780_999522782 -10 Left 999522780 5:152369564-152369586 CCATTGGCACTCATCCAATAAAC No data
Right 999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999522782 Original CRISPR TCCAATAAACATAATGGAGT TGG Intergenic
No off target data available for this crispr