ID: 999528593

View in Genome Browser
Species Human (GRCh38)
Location 5:152436371-152436393
Sequence CACAGGAGAGAGAATGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999528593_999528600 9 Left 999528593 5:152436371-152436393 CCTCCTTCATTCTCTCTCCTGTG No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data
999528593_999528599 3 Left 999528593 5:152436371-152436393 CCTCCTTCATTCTCTCTCCTGTG No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528593_999528597 -6 Left 999528593 5:152436371-152436393 CCTCCTTCATTCTCTCTCCTGTG No data
Right 999528597 5:152436388-152436410 CCTGTGTTTCCAGGAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999528593 Original CRISPR CACAGGAGAGAGAATGAAGG AGG (reversed) Intergenic
No off target data available for this crispr