ID: 999528599

View in Genome Browser
Species Human (GRCh38)
Location 5:152436397-152436419
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999528591_999528599 5 Left 999528591 5:152436369-152436391 CCCCTCCTTCATTCTCTCTCCTG No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528593_999528599 3 Left 999528593 5:152436371-152436393 CCTCCTTCATTCTCTCTCCTGTG No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528592_999528599 4 Left 999528592 5:152436370-152436392 CCCTCCTTCATTCTCTCTCCTGT No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528587_999528599 29 Left 999528587 5:152436345-152436367 CCCTCATTTACTCCCTACATTCA No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528590_999528599 16 Left 999528590 5:152436358-152436380 CCTACATTCATCCCCTCCTTCAT No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528588_999528599 28 Left 999528588 5:152436346-152436368 CCTCATTTACTCCCTACATTCAT No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528594_999528599 0 Left 999528594 5:152436374-152436396 CCTTCATTCTCTCTCCTGTGTTT No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data
999528589_999528599 17 Left 999528589 5:152436357-152436379 CCCTACATTCATCCCCTCCTTCA No data
Right 999528599 5:152436397-152436419 CCAGGAGCCCCTGGAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr