ID: 999528600

View in Genome Browser
Species Human (GRCh38)
Location 5:152436403-152436425
Sequence GCCCCTGGAGAATCAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999528596_999528600 -8 Left 999528596 5:152436388-152436410 CCTGTGTTTCCAGGAGCCCCTGG No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data
999528592_999528600 10 Left 999528592 5:152436370-152436392 CCCTCCTTCATTCTCTCTCCTGT No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data
999528593_999528600 9 Left 999528593 5:152436371-152436393 CCTCCTTCATTCTCTCTCCTGTG No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data
999528589_999528600 23 Left 999528589 5:152436357-152436379 CCCTACATTCATCCCCTCCTTCA No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data
999528590_999528600 22 Left 999528590 5:152436358-152436380 CCTACATTCATCCCCTCCTTCAT No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data
999528591_999528600 11 Left 999528591 5:152436369-152436391 CCCCTCCTTCATTCTCTCTCCTG No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data
999528594_999528600 6 Left 999528594 5:152436374-152436396 CCTTCATTCTCTCTCCTGTGTTT No data
Right 999528600 5:152436403-152436425 GCCCCTGGAGAATCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999528600 Original CRISPR GCCCCTGGAGAATCAGGCAC TGG Intergenic
No off target data available for this crispr