ID: 999530977

View in Genome Browser
Species Human (GRCh38)
Location 5:152463454-152463476
Sequence TTCAAGAAGCAGACAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999530977_999530982 5 Left 999530977 5:152463454-152463476 CCCTCCCCTGTCTGCTTCTTGAA No data
Right 999530982 5:152463482-152463504 GTGAAGTCCTCCTTTATCCAAGG No data
999530977_999530987 26 Left 999530977 5:152463454-152463476 CCCTCCCCTGTCTGCTTCTTGAA No data
Right 999530987 5:152463503-152463525 GGACAGCCGGTATCAGCCTCAGG No data
999530977_999530984 13 Left 999530977 5:152463454-152463476 CCCTCCCCTGTCTGCTTCTTGAA No data
Right 999530984 5:152463490-152463512 CTCCTTTATCCAAGGACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999530977 Original CRISPR TTCAAGAAGCAGACAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr