ID: 999533525

View in Genome Browser
Species Human (GRCh38)
Location 5:152489411-152489433
Sequence CAACCTTCTCCCCTTGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999533525_999533532 0 Left 999533525 5:152489411-152489433 CCCCATTCAAGGGGAGAAGGTTG No data
Right 999533532 5:152489434-152489456 AAGAAGGGGATGAGTTACGTGGG No data
999533525_999533535 30 Left 999533525 5:152489411-152489433 CCCCATTCAAGGGGAGAAGGTTG No data
Right 999533535 5:152489464-152489486 AGAACTCTGCCTATGAAGGTAGG No data
999533525_999533534 26 Left 999533525 5:152489411-152489433 CCCCATTCAAGGGGAGAAGGTTG No data
Right 999533534 5:152489460-152489482 CCTTAGAACTCTGCCTATGAAGG No data
999533525_999533531 -1 Left 999533525 5:152489411-152489433 CCCCATTCAAGGGGAGAAGGTTG No data
Right 999533531 5:152489433-152489455 GAAGAAGGGGATGAGTTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999533525 Original CRISPR CAACCTTCTCCCCTTGAATG GGG (reversed) Intergenic
No off target data available for this crispr