ID: 999536568

View in Genome Browser
Species Human (GRCh38)
Location 5:152523786-152523808
Sequence GGGTAAGAAGAGATGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999536560_999536568 -1 Left 999536560 5:152523764-152523786 CCAGGAGACCAGTTAATAACCTG No data
Right 999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG No data
999536554_999536568 28 Left 999536554 5:152523735-152523757 CCCCGGTTGGAGAGGAGCAGGAG No data
Right 999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG No data
999536555_999536568 27 Left 999536555 5:152523736-152523758 CCCGGTTGGAGAGGAGCAGGAGG No data
Right 999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG No data
999536557_999536568 26 Left 999536557 5:152523737-152523759 CCGGTTGGAGAGGAGCAGGAGGG No data
Right 999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG No data
999536563_999536568 -9 Left 999536563 5:152523772-152523794 CCAGTTAATAACCTGGGTAAGAA No data
Right 999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999536568 Original CRISPR GGGTAAGAAGAGATGGGGCT AGG Intergenic
No off target data available for this crispr