ID: 999538172

View in Genome Browser
Species Human (GRCh38)
Location 5:152541618-152541640
Sequence TTAGATGCTTAGCTTAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999538169_999538172 -9 Left 999538169 5:152541604-152541626 CCCATTTGTGGCTATTAGATGCT No data
Right 999538172 5:152541618-152541640 TTAGATGCTTAGCTTAGGAGTGG No data
999538167_999538172 14 Left 999538167 5:152541581-152541603 CCTTGGCAGAGGAATCACTTTAA No data
Right 999538172 5:152541618-152541640 TTAGATGCTTAGCTTAGGAGTGG No data
999538170_999538172 -10 Left 999538170 5:152541605-152541627 CCATTTGTGGCTATTAGATGCTT No data
Right 999538172 5:152541618-152541640 TTAGATGCTTAGCTTAGGAGTGG No data
999538166_999538172 22 Left 999538166 5:152541573-152541595 CCAAATTACCTTGGCAGAGGAAT No data
Right 999538172 5:152541618-152541640 TTAGATGCTTAGCTTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999538172 Original CRISPR TTAGATGCTTAGCTTAGGAG TGG Intergenic
No off target data available for this crispr