ID: 999545004

View in Genome Browser
Species Human (GRCh38)
Location 5:152618182-152618204
Sequence AAACATATACAGATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999545004_999545009 19 Left 999545004 5:152618182-152618204 CCCACCTCCATCTGTATATGTTT No data
Right 999545009 5:152618224-152618246 TCCCTGCTGAAAGACCTACCAGG No data
999545004_999545011 20 Left 999545004 5:152618182-152618204 CCCACCTCCATCTGTATATGTTT No data
Right 999545011 5:152618225-152618247 CCCTGCTGAAAGACCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999545004 Original CRISPR AAACATATACAGATGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr