ID: 999545273 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:152622500-152622522 |
| Sequence | AAGGGTGACCAGGATGATGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 999545273_999545279 | 18 | Left | 999545273 | 5:152622500-152622522 | CCATCATCATCCTGGTCACCCTT | No data | ||
| Right | 999545279 | 5:152622541-152622563 | AGACCTCCTGAAGCTCTTTTTGG | No data | ||||
| 999545273_999545282 | 26 | Left | 999545273 | 5:152622500-152622522 | CCATCATCATCCTGGTCACCCTT | No data | ||
| Right | 999545282 | 5:152622549-152622571 | TGAAGCTCTTTTTGGAATTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 999545273 | Original CRISPR | AAGGGTGACCAGGATGATGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||