ID: 999545273

View in Genome Browser
Species Human (GRCh38)
Location 5:152622500-152622522
Sequence AAGGGTGACCAGGATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999545273_999545279 18 Left 999545273 5:152622500-152622522 CCATCATCATCCTGGTCACCCTT No data
Right 999545279 5:152622541-152622563 AGACCTCCTGAAGCTCTTTTTGG No data
999545273_999545282 26 Left 999545273 5:152622500-152622522 CCATCATCATCCTGGTCACCCTT No data
Right 999545282 5:152622549-152622571 TGAAGCTCTTTTTGGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999545273 Original CRISPR AAGGGTGACCAGGATGATGA TGG (reversed) Intergenic
No off target data available for this crispr