ID: 999546256

View in Genome Browser
Species Human (GRCh38)
Location 5:152631860-152631882
Sequence TGCTAAGTATCACTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999546256_999546260 1 Left 999546256 5:152631860-152631882 CCATCCACCAGTGATACTTAGCA No data
Right 999546260 5:152631884-152631906 CTACTATGCATGACCAAAGGTGG No data
999546256_999546259 -2 Left 999546256 5:152631860-152631882 CCATCCACCAGTGATACTTAGCA No data
Right 999546259 5:152631881-152631903 CATCTACTATGCATGACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999546256 Original CRISPR TGCTAAGTATCACTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr