ID: 999546260

View in Genome Browser
Species Human (GRCh38)
Location 5:152631884-152631906
Sequence CTACTATGCATGACCAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999546257_999546260 -3 Left 999546257 5:152631864-152631886 CCACCAGTGATACTTAGCATCTA No data
Right 999546260 5:152631884-152631906 CTACTATGCATGACCAAAGGTGG No data
999546258_999546260 -6 Left 999546258 5:152631867-152631889 CCAGTGATACTTAGCATCTACTA No data
Right 999546260 5:152631884-152631906 CTACTATGCATGACCAAAGGTGG No data
999546255_999546260 13 Left 999546255 5:152631848-152631870 CCATTGGATAAACCATCCACCAG No data
Right 999546260 5:152631884-152631906 CTACTATGCATGACCAAAGGTGG No data
999546256_999546260 1 Left 999546256 5:152631860-152631882 CCATCCACCAGTGATACTTAGCA No data
Right 999546260 5:152631884-152631906 CTACTATGCATGACCAAAGGTGG No data
999546254_999546260 28 Left 999546254 5:152631833-152631855 CCTTGGTAACAGTCTCCATTGGA No data
Right 999546260 5:152631884-152631906 CTACTATGCATGACCAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999546260 Original CRISPR CTACTATGCATGACCAAAGG TGG Intergenic
No off target data available for this crispr