ID: 999553346

View in Genome Browser
Species Human (GRCh38)
Location 5:152714656-152714678
Sequence ATATGCCCTATGGACAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999553346_999553350 -5 Left 999553346 5:152714656-152714678 CCTAGGTTGTCCATAGGGCATAT No data
Right 999553350 5:152714674-152714696 CATATACTCCTAGGGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999553346 Original CRISPR ATATGCCCTATGGACAACCT AGG (reversed) Intergenic
No off target data available for this crispr